1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Molodets [167]
3 years ago
10

Geographic isolation may result in A. extinction B. speciation

Biology
2 answers:
Elis [28]3 years ago
7 0

Answer:

speciation, This might be right.

Explanation:

dsp733 years ago
6 0
I agree speciation . We’re all stuck at home leaving people to produce more children if you get what I mean .
You might be interested in
Many voluntary associations are controlled by
Juliette [100K]
It is the motor cortex of the brain that controls the voluntary movements of the body. It is in the rear part of the frontal lobe and is a region in the cerebral cortex.  It is responsible for planning, control and the execution of the voluntary movements in the body. 
6 0
3 years ago
Differential survival and reproduction is best described by which term? natural selection creationism inheritance of acquired ch
Sophie [7]
I believe it is natural selection. Natural selection is when over a period of time, traits that are formed to help the organism survive, are passed to the next generation. For example, if there were two types of rabbits. One had black fur and the other was white. They both lived in the artic. The black furred rabbits are mostly eaten by predators because their black fur is easily seen against the ice and snow. Over a period of time, the black furred rabbit would die out. The next generation would mostly have white fur to help them survive.
5 0
4 years ago
Diapedesis is the process by which red blood cells move into tissue spaces from the interior of blood capillaries. True or False
Lana71 [14]

Answer:

False

Explanation:

Diapedesis is the process by which white blood cells move into tissue spaces from the interior of blood capillaries. It is the process of emigration of WBCs from the bloodstream. With the help of adhesion molecules, WBCs become attached to the endothelium of the blood vessels and squeeze between these cells. The adhesion molecules bind to the sugar moieties present on the surface of WBCs. Phagocytic WBCs such as neutrophils arrive at the site of infection by the process of diapedesis only.  

7 0
4 years ago
Read 2 more answers
What are chromosomes?
Marta_Voda [28]
A threadlike strucure of nucleic acid 

3 0
4 years ago
Read 2 more answers
In the summer, water lilies produce large yellow flowers.
MAVERICK [17]

Answer:

The flowers float on the surface of the pond. Suggest one way these colourful floating flowers help the water lily to reproduce. (e) When water lilies cover the pond surface with leaves, the pond does not get as hot during the day.

7 0
3 years ago
Other questions:
  • How do flowering plants reproduce by fertilization if they are immotile?
    5·1 answer
  • What is 46×28 and all other vines That Got the same thing​
    5·1 answer
  • How does an increased population size affect the amount of competition between organisms?
    8·1 answer
  • Why were Cynognathus fossils were important to Wegener's theory?
    10·1 answer
  • What are the reaming parts bacteria work on
    14·1 answer
  • sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
    7·1 answer
  • How many codons equals 1 amino acid?
    6·1 answer
  • NO LINKS I WILL REPORT U
    11·2 answers
  • What does the strength of friction
    14·1 answer
  • Salivary amylase is an enzyme released from the salivary glands that breaks some of the chemical bonds in?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!