Groundwater contamination occurs when man-made products such as gasoline, oil, road salts and chemicals get into the groundwater and cause it to become unsafe and unfit for human use. ... Road salt, toxic substances from mining sites, and used motor oil also may seep into groundwater.
(Didn’t apply the statements so I answered the question hope I helped!)
Mark as brainliest please!~
Cortez set the basis for social, economic, ethnic, religious, political changes in what is now Mexico, which was of great benefit for the Spanish, but devastating to the local populations.
Explanation:
Hernan Cortez was a Spanish conquistador. He was sent in what is now Mexico in order to gain territory for the Spanish crown, and get as much wealth as possible. In order to do so, Cortez was merciless, and that had devastating effects on the locals.
The Spanish conquistadors massacred the local populations. They destroyed their culture, their cities, and gave their best to assimilate them. On top of that, the diseases that spread out from the Spanish killed off much of the local populations.
Cortez, and the other conquistadors, took every piece of gold and silver they were able to get their hands on, robbing the region. For the Spanish that was of great benefit though, as they became very wealthy and powerful.
Some of the people that suffered from Cortez and the other conquistadors were:
- Aztecs
- Zapotecs
- Toltecs
- Maya
- Tlaxcala
- Mixtec
Learn more about the Maya Civilization brainly.com/question/856999
#learnwithBrainly
Answer:
Because they happen naturally.
Explanation:
climate changes are natural to our planet and happen over time, according to the factors that act on the planet. In this way, climate changes should not be a concern for us, the problem is the speed with which they are happening.
Human activities use a lot of fossil fuels that stick to the atmosphere and accelerate these changes, which cause serious problems in the life of the planet.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:The inner core, on average, rotates eastward. At the speeds it travels, it might, on average, complete a revolution every 750 to 1,440 years.
