1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
malfutka [58]
3 years ago
13

Which of the following accurately describes nutrient limitation?

Biology
1 answer:
Cloud [144]3 years ago
5 0

Answer is c. If one essential nutrient within an ecosystem runs out, primary productivity will be limited

According to Vitousek et al., 2010, nutrient limitation defined as meaningful additions of an essential element in biologically available forms which increases the rate of primary productivity or increase in the biomass in an ecosystem. Alternately, nutrient limitation may also explained as when the supply of one essential nutrient of the ecosystem runs out the primary productivity of the plants will be limited.

You might be interested in
Why do plants not need heterotrophs
o-na [289]
Heterotrophs contrast with autotrophs<span>, such as </span>plants<span> and </span>algae<span>, which can use energy from </span>sunlight(photoautotrophs) or inorganic compounds (lithoautotrophs<span>) to produce </span>organic compounds<span> such as </span>carbohydrates<span>, </span>fats<span>, and </span>proteins<span> from inorganic </span>carbon dioxide. These reduced carbon compounds can be used as an energy source by the autotroph and provide the energy in food consumed by heterotrophs. Ninety-five percent or more of all types of living organisms are heterotrophic, including all animals and fungi and most bacteria and protists.<span>[4]</span>
3 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
2 years ago
Where does a peptide bond form?
Paul [167]
A Peptide bond is formed between two molecules 
Example: when Carboxyl group and amino group form its releasing a water molecule. (H2O) well i hope this help i did my research c: 
3 0
2 years ago
Read 2 more answers
The output region is the site of ______________________.
tester [92]

Answer:

The correct answer is option C (voltage gated Na+ channels).

Explanation:

Output region or axon terminal is the structure of neuron which transmits the signals to other nerve cells.

The signal is transferred via action potential generated by the dendrite cell which moves along the axon and reaches the synaptic junction.  

At the synaptic junction, voltage-gated channel (Na+) channels located in the membrane of the axon terminal cell opens due to the changes in the electric membrane potential which play important role in returning the depolarized cell to a resting state.

Thus, option C (voltage-gated Na+ channels) is the correct answer.

7 0
2 years ago
when considering maintenance of a healthy weight, nutrient needs are affected by affected by all of the following except. A. age
DedPeter [7]
The answer is B.race

7 0
3 years ago
Read 2 more answers
Other questions:
  • Donna is studying phase changes. She claims that since the three phases have different amounts of energy, molecules in substance
    12·2 answers
  • In one type of plant, orange petals (O) are dominant over yellow petals (o) and tall stems (T) are dominant over short stems (t)
    5·1 answer
  • Name three STIs that can be life-threatening or lead to life-threatening illnesses.
    12·2 answers
  • Explain how competition limits a population's growth.
    9·2 answers
  • Some viruses attack cells by inserting their own DNA into the host cells’ DNA. Why might it be simpler for these viruses to atta
    11·1 answer
  • Fax about blue eyes i don't mind two BRAINLES​
    15·2 answers
  • I can't stop farting.​
    11·2 answers
  • If two fossils are found in the same rock layer, what does that say about the age of the fossils?
    10·2 answers
  • All you need is in the photo <br><br><br>ASAP​
    7·1 answer
  • Summary about DNA , Genes , Traits , Chromosomes. (Explain &amp; let me know about all 4 words. Summarize all these words.) Writ
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!