1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Damm [24]
3 years ago
15

Which of the following is the term for an abnormally low white blood cell count?

Biology
1 answer:
Nikolay [14]3 years ago
4 0

Answer:

The correct answer is- Leukopenia

Explanation:

White blood cells are present in our blood which protect our body from foreign antigens like bacteria, viruses, etc. When these white blood cells decrease abnormally in number then this condition is called leukopenia.

White blood cells contain different cell which protect our body from different type of infections. So there are different types of leukopenia according to the particular white blood cell whose number became low.

For example when neutrophils number in the body decrease it is called neutropenia. So the correct answer is leukopenia.

You might be interested in
A man and his wife both have normal vision, but their son is colorblind. Which parent, the mother or the father gave the son the
cupoosta [38]

Answer:

both parents

Explanation:

both parents are recessive

5 0
4 years ago
Read 2 more answers
After a major crude oil spill, a variety of specific microbes is distributed in the area of the spill. this would be an example
jasenka [17]

After a major crude oil spill, a variety of specific microbes is distributed in the area of the spill. this would be an example of Bioremediation

<h3>What is Bioremediation ?</h3>

A subfield of biotechnology called "bioremediation" uses living things like bacteria and microorganisms to clean up contaminated environments. It is used to clean up poisons, pollutants, and other contaminants from water, soil, and other habitats.

  • Bioremediation refers to the removal of biological fluids and blood that may include pathogens like hepatitis, HIV, and MRSA or pose other health problems. Crime scene cleaners employ enzyme cleansers rather than conventional cleaning products like bleach or ammonia to get rid of dangerous compounds from the site.

  • Microbial bioremediation, phytoremediation, and mycoremediation are a few of the most popular types of bioremediation.

Learn more about Bioremediation here:

brainly.com/question/26430794

#SPJ4

8 0
2 years ago
What happens in a warm front​
Naya [18.7K]

Answer: A warm front forms when a warm air mass pushes into a cooler air mass, also shown in the image. Warm fronts often bring stormy weather as the warm air mass at the surface rises above the cool air mass, making clouds and storms.

4 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
This is an excerpt from "When We Two Parted" by Lord Byron.
Diano4ka-milaya [45]
The main theme of the poem is the regret and sorrow the narrator feels about the end of his relationship with the woman in the poem, described only as "you." The poem suggests that the woman may well have been the one to break off the affair: Pale grew thy cheek and col
4 0
3 years ago
Other questions:
  • Wave energy is a type of ocean based renewable energy source that uses the power of the waves to generate electricity. Where is
    6·1 answer
  • Predict a potential outcome of a mutated MAD protein
    9·1 answer
  • What is the relationship between blood and urine ?
    15·1 answer
  • Which of the following represents the phases of mitosis in their proper sequence
    8·1 answer
  • What is the function of cell selectivity Permeable plasma membrane
    11·1 answer
  • If marginal cost exceeds average total cost in the short run, it means
    11·1 answer
  • Please answer and finish up the this one
    6·1 answer
  • A tetrad is composed of
    8·1 answer
  • Design a Solution Describe steps you could take to develop an effective method for copying San Francisco sourdough bread. Assume
    12·1 answer
  • What are the small air sacs called that exchange gases in the lungs? valves chambers alveoli nodes.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!