1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vfiekz [6]
3 years ago
5

The average composition of the continental crust is represented by the rock _______

Geography
1 answer:
Cloud [144]3 years ago
6 0

Granite. the answer is c.

You might be interested in
Why was the European Bank for Reconstruction and Development founded?
34kurt
B. To aid Eastern European countries. Since they were all war-torn in the 1920-1940, they all agreed that the country that damages the other must pay their debts that they created with war violence.
7 0
3 years ago
~~True Or False~~
morpeh [17]
False, the outer planets are gaseous.

True.
5 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
There are many technologies that reduce the amount of carbon emissions into our atmosphere. Identify some example of these techn
Sonja [21]

Answer:

The hybrid cars

Explanation:

It reduce the carbon emissions because it use other types of energy such as calorific when the car brakes friction is created and the car motor serves as a converter to electrical energy to take them to the car batteries and put it to use

5 0
3 years ago
Primero or secondary sources? a t-shirt from a rock concert
o-na [289]
Secondary source as it is not direct :)
6 0
3 years ago
Other questions:
  • In Brazil, the indigenous population was around 3.5 million before the arrival of Europeans. Today, the indigenous population is
    12·1 answer
  • The star HD 12661 is located at a distance of 121 light years, on the border of the constellation Aries near Triangulum. The pla
    15·1 answer
  • Inspired by Valentine's Day, Bob decides to travel to Buenos Aires, Argentina (in South America) so he can learn the tango. Shou
    15·1 answer
  • What is the body of water that is part of the atlantic ocean
    10·1 answer
  • Which type of weather is most likely produced by a cold front? A. light to moderate precipitation B. no precipitation C. heavy p
    6·2 answers
  • Where are the two warm core eddies located in relation to the main gulf streakm current
    7·1 answer
  • What are the four countries with the largest land areas in the western hemisphere?
    10·1 answer
  • Discuss the following terms using internet or library resource.a.Epicenterb.focus.c.seismic wave answer?
    10·1 answer
  • At what type of plate boundary do collisions between plates occur?
    15·2 answers
  • Which part of india does experience the highest diurnal range of temperature and why.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!