1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fredd [130]
3 years ago
7

Explain how an immune response starts after a macrophage attacks a pathogen.

Biology
1 answer:
a_sh-v [17]3 years ago
3 0
After the macrophage fails the Helper T Cell stimulates the B cells (create antibodies) if pathogen is extracellular and Cytotoxic T Cells (killer T cells, release perforin) if pathogen is intracellular. Once the pathogen is killed the B Cells create Memory B Cells and the Killer T Cells create memory T Cells. 
<span>Hope that's helpful.</span>
You might be interested in
In AB blood, the A and the B alleles have?
Rina8888 [55]

Answer:

In AB blood, the A and the B alleles have?

Explanation:

They have codominance.

4 0
3 years ago
Which scientists helped to determine the shape of DNA
Volgvan

Answer:

James Watson and Francis Crick solved the structure of DNA. Rosalind Franklin and Maurice Wilkins, also contributed to this discovery.

Explanation:

7 0
3 years ago
Read 2 more answers
Can somebody help me with this ?
SIZIF [17.4K]
Well for the latitude add 5 but for the longitudei dont know, try adding 2 and find the pattern.
7 0
3 years ago
Gene mutations that result in cancer often cause the
Anarel [89]
Gene mutations that result in cancer often cause the cells to divide uncontrollably. When too many cells are made to quickly it develops into a tumor which usually leads to cancer.<span />
4 0
4 years ago
What types of individuals in a population are represented by the two ends of a bell curve?
Kitty [74]
<span>The individuals with extreme variations of a trait.</span>
4 0
3 years ago
Other questions:
  • What is one reason why the classification of protists in one kingdom is difficult?
    11·1 answer
  • What is speciation?
    7·2 answers
  • Why is not recommended to use antibiotics often
    12·2 answers
  • 1.) You are studying P120, a protein of 120 KDa that is continuously synthesized in eukaryotic cells. Its cellular concentration
    7·1 answer
  • When the shell of a pteropod (sea butterfly) was placed into seawater with the pH expected at the end of the century, the shell
    13·1 answer
  • True or False:<br> Glycolysis joins glucose to other molecules to make pyruvate.
    11·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What is the main difference between the intertidal zone and the neritic zone?
    5·2 answers
  • What genetic technology involves inserting a gene into an organism’s DNA?
    8·2 answers
  • Need help with number 2 and 5 ​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!