1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
3 years ago
10

How does artificial selection supports Darwin's hypothesis ​

Biology
2 answers:
dimulka [17.4K]3 years ago
6 0

It helped him because you can breed certain traits you want in things to get the traits you want

White raven [17]3 years ago
6 0

<em>Darwin hypothesized that artificial selection and natural selection functioned the same way, wherein traits that were desirable gave the individuals an advantage: Those who could survive would live long enough to pass the desirable traits on to their offspring.</em>

You might be interested in
What life changes do people<br> face in middle adulthood?
MissTica

Answer:

Middle adulthood, or middle age, is the time of life between ages 40 and 65. During this time, people experience many physical changes that signal that the person is aging, including gray hair and hair loss, wrinkles and age spots, vision and hearing loss, and weight gain, commonly called the middle age spread

Explanation:

8 0
3 years ago
Help asap will mark brainliest
charle [14.2K]

Answer:

second one

Explanation:

3 0
3 years ago
Tell me one thing you know about replication.
olchik [2.2K]

Answer:

DNA replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. Replication is an essential process because, whenever a cell divides, the two new daughter cells must contain the same genetic information, or DNA, as the parent cell.

Thats one thing ;)

8 0
3 years ago
Read 2 more answers
Honeybees have been declining at dramatic rates in the last few years. Colony collapse disorder has been linked to a virus and r
guapka [62]

Answer:

The given situation is an example of <u>density dependent factor</u>.

Explanation:  

The density dependent factors are the factors that regulate the growth of a population. It is defined as the factors whose effects on the growth or size of a given population vary with the population's density. The various types of density dependent limiting factors are diseases, migration, safe drinking water, food availability, migration etc.

<u>Therefore, the given situation is an example of density dependent factor.</u>

5 0
3 years ago
Read 2 more answers
What is the difference between endocytosis and exocytosis?
Aleks [24]

Answer: D

Explanation:

Endocytosis is the process of capturing a substance or particle from outside the cell by engulfing it with the cell membrane, and bringing it into the cell. Exocytosis describes the process of vesicles fusing with the plasma membrane and releasing their contents to the outside of the cell.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The type of society that has the greatest energy needs is the
    11·1 answer
  • What is the bruising of brain tissue as the result of a head injury?
    10·1 answer
  • What part of your brain controls your emotions
    12·1 answer
  • (tco 5) which mineral is needed for the proper functioning of nerves, muscles, and bones?
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • During photosynthesis, ___________ energy is converted into ____________ energy.
    15·1 answer
  • What are the characteristics of sustainable development?
    14·1 answer
  • 1. What would happen if there wasn't any wind?
    11·2 answers
  • the factor that has most likely influenced the genesis of hemolytic uremic syndrome, involving the acquisition of genes from shi
    11·2 answers
  • Give two examples of a deuterostome and two examples of a protostome.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!