1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dimas [21]
3 years ago
15

What are differences about Early earth and Modern earth?

Biology
1 answer:
aleksklad [387]3 years ago
5 0
Formation of the Earth's Atmosphere. The early Earth was very different from our Earth today. The early Earth experienced frequent impacts from asteroids and meteorites and had much more frequent volcanic eruptions. There was no life on Earth for the first billion years because the atmosphere was not suitable for life.
You might be interested in
What is the advantage of sexual reproduction?<br> what is the advantage of sexual reproduction?
Alik [6]

Answer:

The advantage is that it creates a new generation and furthers the growth of a species.

Explanation:

6 0
3 years ago
How the extensive regenerative power of planaria and starfish may be used as a mean of asexual reproduction
Ostrovityanka [42]
<span>Planaria have a huge regenerative power because of the presence of adult stem cells called neoblasts. If you cut Planaria into pieces, each piece can regenerate into a complete organism and that’s a form of asexual reproduction. Cells which are located on the wound site proliferate to form a blastema-mass of cell that will grow into a new organ. Those cells will differentiate into new tissues and regenerate the missing parts.</span>
<span>The similar thing is happening with starfish.</span>
7 0
3 years ago
Fermentation is carried out regularly, and not only during oxygen emergencies, by what organisms?
PolarNik [594]
The answer is B. many fungi and bacteria
3 0
3 years ago
Read 2 more answers
What causes sediments to stick together and become sold rock?
zzz [600]

Answer:

C. pressure is correct

Explanation:

7 0
3 years ago
Read 2 more answers
What would happen to an organism if its cell membranes became permeable to most substances
levacccp [35]

It would die after harmful substances entered the cell. This would happen because it would burst due to over-bulging.

4 0
3 years ago
Other questions:
  • Which of the following statements about the Bohr effect are true? This is the effect of pH on the binding of O2 to Hb. As blood
    12·1 answer
  • _____________________ are the first organisms to colonize an area and begin the process of ecological
    11·1 answer
  • The practitioner of therapeutic touch (tt) is listening with her:
    14·1 answer
  • What is not evidence for plate tectonics? A. the presence of glaciers B. the distribution of earthquakes and volcanoes C. the co
    9·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is true of intercellular signals that do not go through direct connections between cells, such as gap junctions?
    15·2 answers
  • When a scientist is conducting research about all the plants and wildlife in the Mojave Desert as well as the desert’s resources
    8·2 answers
  • 1 point<br> 4. Identify Layer 1 of the Earth<br> 1
    14·1 answer
  • What is the role/function of neurohormones in annelied?​
    12·2 answers
  • The different forms of a gene are called *
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!