1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stells [14]
3 years ago
12

I need help with all the unanswered ones ASAP!!! Thank you so much!!!

Biology
1 answer:
Kaylis [27]3 years ago
6 0
24.) C - a change in DNA coding can lead to a change in the protein that is produced, which changes structure, and therefore, function. 
28.) C - recombinant DNA is artificial, and the other examples can occur naturally 
29.) B - if DNA enters and successfully is produced within a plant cell, but is not originally from the plant cell, then the cell has been transformed. 
You might be interested in
_____ is the process by which indivuduals that are better adapted to their environment are more likely to survive and reproduce
zubka84 [21]
Adaption is the answer for this one.
8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Radiation
Gnesinka [82]
Radiation: is the emission or transmission of energy in the form of waves or particles through space or through a material medium.

Examples: Radio waves, microwaves, infrared, visible light, ultraviolet, x-rays, and gamma radiation
8 0
3 years ago
What makes a hot spring hot?
vladimir1956 [14]
C

Hot springs are heated by the geothermal heat- heat from the Earths interior.
3 0
3 years ago
The model represents the change in the DNA content of a cell during the cell cycle. DNA Content During the Cell Cycle 22 1 Compl
Fittoniya [83]

Answer:

Explanation:

To late?

5 0
3 years ago
Other questions:
  • The data above represent the results of three different crosses involving the inheritance of a gene that determines whether a ce
    5·1 answer
  • Which of these is a compound?
    12·1 answer
  • What is the surgical procedure indicated in the term lithotripsy?
    10·1 answer
  • What are the parts of the lipid?
    9·1 answer
  • What are the "twisty columns" and "rungs" in the DNA?
    13·2 answers
  • What happens if a state’s minimum wage is lower than the federal minimum wage?
    5·1 answer
  • __________ involves providing assistance with daily living activities to an elderly relative who is chronically frail, ill, disa
    15·1 answer
  • What do these have in commmon?<br> friction, air resistance, pushing a box
    6·1 answer
  • Instructions: 1 Using the DNA sequence, make a complementary RNA strand from both the human and the cow. Write the RNA directly
    8·1 answer
  • T or F<br> An invasive species will cause an ecosystem to reach carrying capacity<br> faster
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!