1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
n200080 [17]
3 years ago
11

How does a landform look like and where is it found?

Biology
1 answer:
olya-2409 [2.1K]3 years ago
8 0

Answer:

A landform is a feature on the Earth's surface that is part of the terrain. Tectonic plate movement under the Earth can create landforms by pushing up mountains and hills. Erosion by water and wind can wear down land and create landforms like valleys and canyons.

You might be interested in
1. What is the difference between external and internal fertilization? *
Andru [333]
Internal fertilization is the process when the syngamy (union of male and female gamete) occurs inside the female body after insemination using copulation. In contrast, External fertilization is the syngamy outside the female body, that is in the outer environment especially in water bodies.
7 0
3 years ago
Explain how an aquatic biome could consist of multiple ecosystems. Include at least two examples of ecosystems in your explanati
Roman55 [17]

Answer:

an aquatic ecosystem is an ecosystem in the body of water examples are marine ecosystem and fresh water ecosystem

3 0
3 years ago
Difference between endotoxins and exotoxins
erma4kov [3.2K]
There are two types of toxins; endotoxins and exotoxins. ... On the other hand, endotoxins are less lethal but can cause fever to the host. Exotoxins are secreted by bacteria and release outside the cell whereas endotoxins are bacterial toxins located within the cells.
5 0
3 years ago
If someone got sick with an intestinal infection from eating the yogurt, what type of antibiotics would you prescribe? Why?
garri49 [273]
Probiotics 

and why is down below
Probiotics:   <span> Probiotics are live microorganisms that may be able to help prevent and treat some illnesses. Promoting a healthy digestive tract and a healthy immune system are their most widely studied benefits at this time. These are also commonly known as friendly, good, or healthy bacteria.

That is why i would prescribe it
</span> 
5 0
3 years ago
Definitions
shusha [124]

Answer:

Explanation:

1. Organ

2. Nervous tissue

3. B

4. Tissue

5. Lungs?

6. D

7. C

8. A

9. F

10. E

11. G

12. ?

5 0
3 years ago
Read 2 more answers
Other questions:
  • Why were people getting sick after the removal of the wheat germ
    14·2 answers
  • Plasma membranes of adjacent cardiac muscle cells interlock at specialized regions called intercalated disks. what is the signif
    6·1 answer
  • Some people have freckles, and some people do not have freckles. If a child has freckles, at least one parent has freckles. Howe
    14·2 answers
  • How many kinds of organisms have prokaryotic cells? how many have eukaryotic cells?
    12·1 answer
  • Which fact about fossils is MOST important to scientists who study evolution?
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A hypothesis that appears to be supported by multiple experiments may be elevated to a general _____. experiment hypothesis theo
    11·2 answers
  • After reading the paragraphs below, answer the questions that follow. Bloom syndrome is a rare disease characterized by growth d
    11·1 answer
  • Where are haploid cells found?
    15·2 answers
  • What is the point of inserting needles into incorrect places?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!