1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
15

Help with 23,24,25 please

Biology
1 answer:
nalin [4]3 years ago
8 0

Answer: 23. A

24. C

25. D

Explanation:

You might be interested in
The valve between the distal portion of the esophagus and the stomach is known as the ___ sphincter
Goryan [66]
Lower esophageal sphincter! <span />
7 0
4 years ago
What are 2 cell appendages that help cells move
Over [174]
When You grow or eat or move your body
7 0
3 years ago
Which of these does NOT occur during meiosis? *
Tamiku [17]

Answer:

production of new gene combination

Explanation:

cause it doesnt occur during meiosis

8 0
3 years ago
how does the digestive system help the body maintain homeostasis? if it doesn't function correctly how does it affect the body?
Flauer [41]

Answer:

The bacterial flora in the intestines are essential to homeostasis in the body. They not only break down food so the nutrients can be absorbed, they produce vitamins like biotin and vitamin K and guard against harmful bacteria that enter the system

Explanation:

pls mark me as brainlist

Thank you

8 0
3 years ago
PLEASE ITS DUE TOMORROW<br> what are the 6 summaries of the heliocentric model?
Arisa [49]

Answer:

The Foundations of the Copernican

Revolution

1. Earth is not at the center of everything.

2. Center of Earth is the center of Moon’s orbit.

3. All planets revolve around the Sun.

- but still in circular orbits

4. Earth is just one of the Planets.

5. The stars are very much farther away than the

Sun.

6. The apparent motion of the Sun and stars is due

to Earth’s rotation around itself

5 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Wind moves from an area of high pressure to an area of which type of pressure? A. low B. high C. equal D. cold
    10·2 answers
  • The flow of energy in ecosystem is best described as energy moving in
    7·2 answers
  • Which is one purpose of cell division?. . A.. to create proteins. . B.. to expend energy. . C.. to help the organism grow. . D..
    7·1 answer
  • A proposed theory in the history of evolution where prokaryotic cells engulfed aerobic heterotrophic prokaryotes and photosynthe
    6·1 answer
  • Do you think it is possible to have the benefits of agricultural and industrial revolutions without the environmental costs?
    6·2 answers
  • Precipitation is the loss of water by leaves. true false
    14·2 answers
  • Which are present when freezing rain occurs
    13·2 answers
  • Write a hypothesis that explains how the Hawaiian island chain formed. Explain your hypothesis. Describe how your data supports,
    7·2 answers
  • Identify which properties of water make it a compound necessary for life to exist on our planet. Select all that apply.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!