1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PIT_PIT [208]
3 years ago
9

Help me on this science HW please? 15 points! :) Thanks! ASAP

Biology
1 answer:
Naya [18.7K]3 years ago
3 0
Which Question do you need help with?
You might be interested in
A person high on the trait of __________ will typically follow a script, or a perceptual and behavioral strategy, that involves
ddd [48]

Answer:

The preferable option will be - C.

agreeableness, agreeable.

Explanation:

  • A person who has an alternative character of <u>agreeableness</u> will typically follow a script, or a cascade of perceptual and behavioral strategy, that involves being warm, friendly, approachable, and slow to anger.
  • If a person is <u>agreeable</u>, then he or she will probably not get angry in response to a mild insult.

So, we can say that an agreeable person is more calmer than an agreeableness person.    

7 0
3 years ago
When a peptide hormone reaches its target cell, which event happens next?
Anestetic [448]
<span>It binds itself to the receptors present on the surface of the cell membrane, which activates the enzymes present inside cell. Then It passes through the cell membrane and attaches itself to a receptor protein present in the cytoplasm. It passes on the signal to the secondary messengers inside the cell, which activate the receptors on the cell membrane.</span>
3 0
3 years ago
Which statement is the best physical description of a gene? A chromosome is a segment of a gene. Genes carry many chromosomes. A
Sergio039 [100]

Answer:

The correct option is <em>C. A gene is a specific segment of DNA on a chromosome</em>

Explanation:

Option A is false because a gene is a segment on a chromosome.

Option B is false because a chromosome carries many genes.

Option D is false because a gene carries a segment of DNA, not all of the DNA.

Option C is correct because there are many genes present on a single chromosome. Each gene carries a segment of DNA. The position of a gene on the chromosome is known as its loci.

4 0
2 years ago
A student sees several ants walking up a wall following the exact same trail that an ant took earlier. She wants to apply the sc
BARSIC [14]
<h2>Answer is option "D"</h2>

Explanation:

  • Ants rummage to discover nourishment and take it back to the state. On the off chance that they go over nourishment things that are excessively huge or substantial for a solitary individual to convey, a few species can frame groups to agreeably convey these things to the home. This aggregate route process relies on the navigational capacities of the individual ants.  
  • The direction capacity required of selected people is to follow the aroma of the path, which is kept crisp by the continuous checking conduct of the foragers, as modest drops of the path pheromone are laid on the substrate (e.g., ground, tree trunks).
  • That is the manner by which the ants manage two contending trails of various lengths; the more drawn out course will turn out to be less and less engaging as an ever increasing number of individual specialists are pulled in by the more grounded smell of the shorter way.
  • Hence, the right answer is option D "Hypothesize that the ants are following a scent trall that the first ant left".

4 0
3 years ago
Read 2 more answers
The nurse is reviewing the scanned images of an ultrasonography test of the fetus. the nurse finds that the head and abdominal c
timofeeve [1]
The Child will experience Birth problems or deformity !!!
5 0
3 years ago
Other questions:
  • The healthcare provider prescribes epoetin for a client who has acquired immunodeficiency syndrome (aids). what step will the nu
    11·1 answer
  • Relaying signals from the neuron to other cells is a function of the
    15·2 answers
  • Help ASAP SCIENCE QUESTION
    15·2 answers
  • A mutation may result if the molecule shown is exposed to
    7·1 answer
  • What do scientists need to look at before developing an argument?
    13·2 answers
  • What is an ecological system called that consists of all of its biotic and abiotic factors?
    12·1 answer
  • Two factors that determine the rate of stream erosion
    14·1 answer
  • What makes the study of human development a science
    5·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • A Giant factory farm uses large open lagoons to treat waste from the buildings where hogs are stored. The problem is that the la
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!