1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jet001 [13]
3 years ago
8

What’s X-ray crystallography?

Biology
1 answer:
jek_recluse [69]3 years ago
7 0

Answer: X-ray crystallography is a tool used for determining the atomic and molecular structure of a crystal. The underlying principle is that the crystalline atoms cause a beam of X-rays to diffract into many specific directions. The underlying principle is that the crystalline atoms cause a beam of X-rays to diffract into many specific directions

Explanation:

You might be interested in
Ms. Green's biology students were studying cellular respiration. One simple organism, yeast, can be used to test the rate of fer
SSSSS [86.1K]
The answer is D) a food source
6 0
4 years ago
Read 2 more answers
Which process will create new sand in a desert
Nadya [2.5K]

Answer: Wind-blown sand grains striking any solid object in their path can abrade the surface. Rocks are smoothed down, and the wind sorts sand into uniform deposits. The grains end up as level sheets of sand or are piled high in billowing sand dunes.

Explanation:

8 0
3 years ago
What term can be used to describe all cellular respiration?
anyanavicka [17]
I think the answer is D because respiration releases energy.
6 0
3 years ago
About how thick is the Earth's core?
Alona [7]
The earth's core is divided into two layers: the outer and inner core. The outer core borders the Earth's mantle and is approximately 1,430 miles<span> in thickness. The inner core has a thickness of 750 miles, giving the core a combined thickness of 2180 miles. lol....

I hope this helps!!! :)</span>
4 0
3 years ago
Read 2 more answers
Choose one of the three fossil fuels – coal, oil or natural gas – and describe:
xxMikexx [17]

Answer:

coal is the source of energy and it is formed in the dark mines and there are the fossiles of the ancient tree and animals ect

2. we use the coal in everywhere coal is used in industry and also for petrol and this is very low source on earth

hope ur help and mark me brainlist

7 0
3 years ago
Read 2 more answers
Other questions:
  • What scientific practice is Rhonda performing on what effect the air pressure at high altitude has on a volume of gas in baloons
    5·1 answer
  • How did Nikola Tesla's Personal problems with Thomas Edison change his career and his contribution to society?
    15·1 answer
  • Which two types of RNA pair up using a codon-anticodon link?
    12·2 answers
  • 18) Which process occurs in fungi and has the opposite effect on a cell's chromosome number than does meiosis I?
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Where in a eukaryotic cell does the Electron Transport System operate?
    11·2 answers
  • About what percentage of the United States energy is supplied by nonrenewable resources?
    9·1 answer
  • Which is the BEST description for the process of photosynthesis?
    6·1 answer
  • What is the job of the protons (H+) in the ETC?
    13·1 answer
  • What is the structure and function of genes?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!