1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
9

Reactants bind to the enzyme at the ______.

Biology
1 answer:
o-na [289]3 years ago
4 0

An active site is a region that is present on an enzyme where the reactants or the substrate molecules we can say bind and experience a chemical reaction. The substrate is basically a reactant whose concentration is changing and that is converting into a product after binding at the active site of an enzyme


You might be interested in
porque son los micronutrientes indispensables para los diferentes metabolicas de los organismos vivos?
Kipish [7]

Because they are the essential micronutrients for the different metabolites of living organisms?


8 0
3 years ago
Is the Earth dying? if so answer, and put the reason's why Earth is dying and what we can do to help Earth stop dying.
GenaCL600 [577]

Answer:

Earth has been our place for many years. all inhabitants on earth are causing great destruction. along the way we tried to resolve issues yet some we couldn't figure out. the one we couldn't figure out had made a great impact on our world today. Just how do we stop it? Many ways actually, taking pollution for example. pollution is a great cause for why earth isn't as lively as before. along the years we've polluted 92% of the earths air. causing us to breathe unhealthy air. We can easily fix this problem with finding new ways to get somewhere like riding a bike or taking an energy efficient car. Therefore, we humans have change the world dramatically by doing good things and bad things, too. but in the end we are the ones causing earth to nearly give up, so we can also be the ones to let the earth forgive.

hope this helps you out!

TIP: change it up so you don't do plagiarism:)

 

3 0
3 years ago
Explain in detail malnutrition
Iteru [2.4K]
Malnutrition is the term used for being malnourished, in which a person does not have proper nutrients required for his/her growth
4 0
3 years ago
Read 2 more answers
Pros and cons of canopy fogging
pishuonlain [190]

Pros:

It is (mostly) based on pyrethrine spray which kills the insects rapidly.

It not poisonous to other animals.

It uses synthetic, natural spray which is safe to use because it breaks down within 10 minutes.

Te technique can reach tall forests.

It can be used in closed spaces ( greenhouses, basements etc).

 

Cons:

It requires windless circumstances ( which is mostly at nights).

Breathing fog may cause respiratory and throat irritation to some.

 

5 0
3 years ago
Answer asap will give brain thing
Alenkasestr [34]

Answer:

1. Antonie van Leeuwenhoek made the first microscope and used it to look at bacteria and study bacteria, and Robert Hooke studied cells and saw cavities in the cells that looked like small boxes - he discovered plant cells! he recognized cells as the basic unit of life, a basis for Cell Theory.

2. cell theory is: every living organism is made of one or more cells, cells are the smallest units of life ( that have the properties of a living thing), All cells come from other cells  - all living things come from other living things. This relates to every living thing because all living things come under cell theory - like all living things are made of cells

3. prokaryotes, like bacteria, doesn't have a nucleus covered in a membrane. a eukaryotic cell, like an animal cell, has a membrane covered nucleus. just like the nucleus, in eukaryotes the organelles are not membrane bound. in prokaryotes, the organelles are membrane bound. In prokaryotes the DNA form is circular, while the DNA form in eukaryotes is linear. there are more, but i couldn't list them.

4. Example for prokaryote: the famous (or infamous) E. Coli bacterium. example for eukaryote: Humans!

5. Single-celled organisms (unicellular organisms) have all the functions necessary for their survival in the single cell. Multicellular organisms (many celled organisms), however, need many cells to survive and carry out all the functions necessary for their survival and do the different tasks each cell is supposed to do.

I hope this helped, please do correct me if I am wrong!

Explanation:

8 0
3 years ago
Other questions:
  • An individual's ability to remember the day he or she first swan the length of a swimming pool is most clearly an example of ___
    5·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What mineral is not included in children's multivitamin/mineral supplements because it is a major cause of unintentional poisoni
    12·1 answer
  • A newly pregnant woman is trying to choose a health care provider for her pregnancy and birth. she desires to have the health ca
    11·1 answer
  • How could two genetically identical oak trees have different heights when tree height is a heritable trait?
    11·1 answer
  • The cell cycle has a regular system of checks and balances that prevents damaged or mutated cells from proceeding to the next ph
    10·1 answer
  • Which object is created during the formation of a star?
    7·2 answers
  • How does fungi and bacteria can withstand much greater changes in the surrounding medium than animal cells?​
    7·1 answer
  • From the stomach, food next moves into the ____, which has functions of digestion and absorption
    8·2 answers
  • Complex traits follow different patterns of inheritance and involve multiple genes or other factors these patterns include
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!