1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saul85 [17]
3 years ago
5

Under the Uniform Securities Act, the limited registration provision available to Canadian broker-dealers and their agents permi

t such broker-dealers to:
Law
1 answer:
Tanzania [10]3 years ago
4 0

Answer and Explanation:

Under the Uniform Securities Act, the limited registration provision available to Canadian broker-dealers and their agents permit such broker-dealers to conduct businesses with interested people who reside in Canada; in addition, broker-dealers can also conduct businesses with Canadians who plan to reside in the state on a temporary basis, and whom they were already familiar with, prior to the time they came to the United States.

You might be interested in
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
What is an advantage of filing a tax return?
mojhsa [17]

Answer:

B refunds

Explanation:

This is because most or all refunds are used to pay back any taxes owed.

4 0
2 years ago
What is your fav song? and who made it I love Melanie Martinez
Leona [35]

Answer:

Venom - Eminem

Explanation:

4 0
2 years ago
Ipagpalagay na manunulat ka sa isang magasin bahagi ng inyong trabaho ang pagrerebyu ng pelikula. inatasan ka ng iyong editor na
Anettt [7]

Answer:

I'm sorry, I don't understand...

Explanation:

4 0
3 years ago
How does the exchange rate for a country's currency affect its terms of
scoundrel [369]

Answer:

A. A higher exchange rate for the country's currency can lead to more

favorable terms of trade

Explanation:

Just got it right!

6 0
3 years ago
Read 2 more answers
Other questions:
  • Future changes in automobile technology are likely to include (select all that apply):
    15·1 answer
  • Project understanding police history a timeline project
    13·1 answer
  • Which group would most likely investigate a person accused of election fraud in North Carolina?
    5·2 answers
  • PLEASE HELP!!! Federalism places limits on state governments' power by:
    7·2 answers
  • Give me one word that can describe a diplomat.
    15·2 answers
  • MAJOR GRADE
    15·1 answer
  • Con la evolución del derecho romano y con la expedición del cerebro edicto de Antonio caracalla, se extinguió la clasificación d
    9·1 answer
  • What are the elements of a crime?
    14·1 answer
  • How did saul become king
    8·2 answers
  • Are women more ethical than men in the workplace? What are the ethics underlying your decision? Support your answer with reason.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!