Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Answer:
What force is represented by vector A? C) normal force
If the hockey puck is moving to the right, what will happen when it is hit with a significant force by the hockey stick? normal force
B: the puck will move off in a different direction
Explanation:
If this is the question:
What force is represented by vector A
A: friction
B: gravity
C: normal force
D:push
If the hockey puck is moving to the right, what will happen when it is hit with a significant force by the hockey stick?
A: the pick will continue moving to the right
B: the puck will move off in a different direction
C: the puck will come to a complete stop
Activation energy is the minimum quantity of energy that the reacting species must possess in order to undergo a specified reaction.
for example , striking a match on the side of a matchbox provides the activation energy, in the form of heat produced by friction.
Answer:
Please see the explanation.
Explanation:
Req. a)
Greater susceptibility to infections.
In Leukopenia, the amount of white blood cells becomes lower in the bloodstream. A normal white blood cell usually has 3.5k to 11k white blood cells per micro-liter.
But a leukopenia patient might have a lower number of white blood cells than 3.5k to 11k. White blood cells are which fight against unwanted viruses, bacteria, etc. which enters into the human body. Actually, it works as a guard for humans from being affected by various diseases.S So, it's crucial for the human immune system.
When the amount of white blood cells becomes lower, the body will become less prepared to battle against viruses and infections. So if a person becomes affected by leukopenia, he/she will be more susceptible to the disease.
Req. b)
Transport fluid.
The lymphatic system is an arrangement of different tissues and organs. The lymphatic system helps the body to get rid of poisons, garbage, and as well as from other unwanted elements. Inside the body, lymph is carried out by the lymphatic system. Lymph is a liquid that contains infection-fighting white blood cells. The lymphatic system helps to pass this fluid (lymph) throughout the body so that this lymph can help all cells to get rid of unwanted materials.
