1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
3 years ago
15

The best treatment for a bacterial disease is

Biology
2 answers:
Furkat [3]3 years ago
8 0
B - Antibiotics
Antivirals treat viruses, antifungals treat fungi, and OTC treatments are merely symptomatic treatment. Antibiotics typically dissolve the cell wall of bacteria meaning they explode, so they actually kill the bacteria.

Alex_Xolod [135]3 years ago
6 0
The best treatment for a bacterial disease is antibiotics.

Answer: B. antibiotics
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which is the correct alignment for a solar eclipse?
Elodia [21]
The correct alignment for a solar eclipse is <span>sun - moon - Earth. It is letter A.

>Solar Eclipse--only occurs when </span><span>Moon passes between Earth and Sun
>Its shadow has</span> two parts namely:

<span>1. Penumbra--<span>The Moon's faint outer shadow.
</span>2. Umbra---<span>The Moon's dark inner shadow.</span></span>
3 0
3 years ago
Read 2 more answers
Thermus and Deinococcus A. survive in extreme environments.B. are both thermophilic.C. are both radiation resistant.D. both serv
attashe74 [19]

Answer:

Option a, survive in extreme environments

Explanation:

Both Thermus and Deinococcus belong to the group of bacteria that are collectively termed as Deinococcus–Thermus group.

Deinococcus are radiation-resistant vegetative cell as they are able to resist ionising radiation. Also some species of Deinococcus are thermophile.

Thermus are thermophilic bacteria that are able to live in extreme temperature condition and thus are able to tolerate high temperature.

Hence, option A is correct.

3 0
3 years ago
What is not a property of water that helps make water essential for life on Earth?
Anna007 [38]
So the the main forces that keep the water on the surface of the planet are to do with plate tectonics. If the plates were to stop moving, the water probably would eventually be absorbed into the interior, although this process would take a very long time indeed.
7 0
2 years ago
Light traveling through the air moves in a straight line. An object viewed through water looks different because light rays that
valentina_108 [34]
I think The correct answer is c
4 0
3 years ago
Read 2 more answers
Other questions:
  • Complete the following analogy. Chromosome is to tree as gene is to .
    7·1 answer
  • Which of the following is NOT a solution to lowering atrazine concentrations in aquatic waterways?
    8·1 answer
  • How many ATP molecules are spent during one turn of the Calvin cycle?
    14·1 answer
  • What medicine is recommended for both upper and lower respiratory allergies?
    7·1 answer
  • What does resting potential mean
    14·1 answer
  • Make a diagram of the reproductive cycle of a virus and discuss this form of reproduction with the pandemic situation we are exp
    12·1 answer
  • 1) What type of reproduction is illustrated above?
    9·2 answers
  • Help need pls and thanks
    9·2 answers
  • HELP QUIZ DUE TONIGHT
    9·2 answers
  • During pregnancy, a fetus gets oxygen and nourishment via the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!