1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dimulka [17.4K]
3 years ago
9

Metagenomics (check all that apply): Group of answer choices Can leverage Next Generation Sequencing technology to identify and

characterize organisms. Rarely finds previously unknown microorganisms. Has resources to support analysis at the DOE-JGI site. Can identify microbiologic organisms without traditional isolation and culturing of individual organisms.
Biology
1 answer:
ikadub [295]3 years ago
3 0

Answer:

- Can leverage Next Generation Sequencing technology to identify and characterize organisms

- Has resources to support analysis at the DOE-JGI site.  

- Can identify microbiologic organisms without traditional isolation and culturing of individual organisms.

Explanation:

Metagenomics can be defined as the study of whole genomes of biological communities recovered from environmental samples. This genomic field has enabled the discovery of new species (microorganisms) and their effects on the environment. Next-Generation Sequencing (NGS) technologies allow to obtain huge amounts of genomic data, which has been a limitation in genomics and metagenomics. Metagenomic NGS (mNGS) is a technique used for sequencing nucleic acids present in a biological sample containing mixed populations of microorganisms. Finally, the Department of Energy Joint Genome Institute (DOE JGI) is a referent in metagenomic analysis, especially in genome assembly data obtained from microbial communities. This Science User Facility has developed a series of bioinformatics tools and databases in order to analyze metagenomic information.

You might be interested in
What is created by the flow of electric current?
GREYUIT [131]

A magnetic field is created by the flow of an electric current.

4 0
2 years ago
Read 2 more answers
Which is the definition of an amino acid?
ra1l [238]

Answer:

I'm pretty sure it's a protein building block

6 0
3 years ago
What four characteristics of an aquatic environment might make photosynthesis or life processes difficult for aquatic plants? Li
elena55 [62]

Answer:

Hello there, I will give the answer

Explanation:

Aquatic plants require special adaptations for living submerged in water, or at the water's surface. The most common adaptation is the presence of lightweight internal packing cells, aerenchyma, but floating leaves and finely dissected leaves are also common.

4 0
3 years ago
What is the role of the water test tube in each phase
ElenaW [278]
I need more information
7 0
3 years ago
If a plant's leaves developed so that its vascular tissue only contained xylem, how would this affect the rest of the plant's ph
Snezhnost [94]

Answer:

If a plant's leaves only contained the vascular tissue xylem, then it will not be possible for the plant to absorb carbon dioxide. As carbon dioxide is required for photosynthesis to occur, this means that the process of photosynthesis will not take place. As a result, the plant will not be able to produce food as photosynthesis is the process by which plants make food. This will result in the plant to die eventually in the end due to lack of food.

4 0
3 years ago
Other questions:
  • Anthony still insists that he needs an antibiotic to treat his viral infection. explain to him why an antibiotic will not help h
    9·1 answer
  • Adenosine triphosphate, or ATP, is primarily used as _______ in living organisms.
    11·2 answers
  • An atom of the element ____________has an average atomic mass of about 16 amu.
    12·2 answers
  • How are salts formed?
    10·1 answer
  • The term meaning situated nearest the midline or beginning of a body structure is __________.
    14·1 answer
  • The pituitary gland releases a growth hormone during what stage of sleep
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Dissolved solutes alter some physical (colligative) properties of the solvent. In nucleotides and nucleic acids, syn and anti co
    5·1 answer
  • A community in the final stage of succession - a community remains relatively unchanged until destroyed by an event such as fire
    14·1 answer
  • Which of the following requires treatment with both antibiotics and antitoxins? A) diphtheria. B) tuberculosis. C) whooping coug
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!