1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
4 years ago
9

Dehydration synthesis is a process in which

Biology
1 answer:
kramer4 years ago
8 0

Answer:

Water (H2O) is drawn out of two small molecules to combine them into one large molecule

You might be interested in
if a man with type ab blood marries a woman heterozygous for type A what is the probability that their child would be type B???
Anna11 [10]

Answer:

1/4.

Explanation:

Via a punett square, the only possible combinations are AA, AB, AO and BO. Since BO is the only way the child has type B, the chances are 1 in 4.

8 0
3 years ago
The figure below shows a food chain that might exist in a meadow.
irinina [24]
B. Toad i believe that’s the answer not sure
7 0
3 years ago
Which blood cell spend most of their time in the lymphatic system?
vampirchik [111]

White blood cells.

Hope this helps!

3 0
4 years ago
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
when a piece of zucchini is soaked in salt water, the zucchini loses its firmness. Which process best explains what happens to t
Semmy [17]

Explanation:

The zucchini is breaking down which we already know bit the zuchinni is absorbing and breaking down at the same time so when that happens the cells are expanding and breaking

think of a water balloon

4 0
3 years ago
Other questions:
  • What is not true of plasma membranes?
    13·1 answer
  • A person who has been arrested for robbery should be referred to as:
    8·1 answer
  • The diet planning principle nutrient density is best represented by choosing foods that:
    13·1 answer
  • How does reducing gene flow cause speciation
    13·2 answers
  • (06.03 lc) what is the most common bacterial sexually transmitted infection, which left untreated can lead to pelvic pain, pelvi
    13·1 answer
  • A woman with hemophilia and a man without hemophilia get married. What are the chances that their first child will have hemophil
    10·2 answers
  • The gene for wing shape in fruit flies has two alleles; P codes for oval-shaped wings and p codes for heart-shaped wings. P is c
    15·1 answer
  • A client has been training in phase 2 for 4 months. she is now experienceing joint pain and emotional fatigue. what stage of the
    14·1 answer
  • I am fairly small and I am in animal cells. I help the animal cells break down molecules by emptying out my enzymes to speed up
    7·1 answer
  • How gamete formation leads to genetic variation.​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!