1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
2 years ago
6

Answer the following questions.

Biology
1 answer:
Dafna1 [17]2 years ago
6 0

Answer: reading paper books and magazines,  sleeping in beds under cotton sheets, having a sandwich for lunch , sitting at wooden desks , I picking wildflowers , eating a favorite breakfast cereal.

Explanation: These are all correct because each has to deal with plants. For example, reading the paper books, sleeping in the bed and sitting at the wooden desk all have to due with the products that come from plants. Paper, cotton, and wood are all grown from plants and turned into resources. Next picking flowers, eating foods are also direct examples of how plants help us. Picking flowers that come directly from plants. Then eating food that is grown from plants shows that it is directly plants providing for humans.

You might be interested in
Which is the largest of the rotator cuff muscles
marysya [2.9K]

Rotator cuff mucles :)

4 0
3 years ago
If a person has adapted to an environment, they have __________. a. maintained their unique customs to help them survive b. adju
nirvana33 [79]

Answer:

I think the answer is either B or D

5 0
1 year ago
NOT a convergent boundary
kenny6666 [7]
Continental-volcanic is NOT a convergent boundary. The answer to your question is B. I hope this is the answer that you are looking for and it comes to your help.
5 0
3 years ago
Base substitutions in coding regions that result in changed amino acids are called
Cerrena [4.2K]
Missense mutations.

Hope this helps!
7 0
3 years ago
In a well-balanced ecosystem, squirrels eat nuts, raccoons feed on squirrels, and bears feed on raccoons. It was observed that t
BlackZzzverrR [31]
Trophic levels go by, 
Producer (The nuts)
Primary Consumer (Squirrels)
Secondary Consumer (Raccoons)
Tertiary Consumer (Bear)


So squirrels would be at a lower trophic level.
 Hope his help :)

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following partially determines the amount of energy carried by a water wave?
    5·1 answer
  • Unlike the abdominal viscera the thoracic viscera is separated into two compartments by an area called the mediastinum. What is
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Mutations that occur due to the environment are the result of: *
    10·2 answers
  • A mineral must be formed by a manufactured process to be considered a mineral. Please select the best answer from the choices pr
    12·2 answers
  • Which of the following prevents blood from flowing backward through the circulatory system?
    11·1 answer
  • Which molecule is used to tell tRNA which amino acid is needed?
    6·2 answers
  • Which are examples of genetic engineering? Check all that apply.
    12·2 answers
  • 8. What factor contributes the most to the overall health and sustainability of an<br> ecosystem?
    15·2 answers
  • What are bacteria that can produce their own food without using the sun's energy called?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!