1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
3 years ago
14

Identify two activities that change the amount of CO2 in the atmosphere over time

Biology
1 answer:
nydimaria [60]3 years ago
4 0
It’s astronomical to be the answer
You might be interested in
CHECK IF THE FIRST ONE IS RIGHT AND ANSWER THE SECOUND ONE Only answer if you know its right 13 POINTS :)
Thepotemich [5.8K]
The first has to be changed to dwarf star, and the second one is the effect of solar winds. Hope this helps!
6 0
4 years ago
Read 2 more answers
Which of the following is a possible long-term consequence of two organisms occupying the same niche? a. Local extinction b. Coo
Lemur [1.5K]
Niche refers to the role of the microorganism or a living thing in an ecosystem. When two organisms occupying the same niche, the possible long-term consequence isA. local extinction. This is because the relationship is competition which can outlast the other. Eventually, when the environment is changed, the organisms adapt too which erases the original attributes. 
8 0
3 years ago
Read 2 more answers
Cocaine exerts its pleasurable effects on the brain by:
Semenov [28]

It disconnects the brain's dopamine system.

Further explanation

Cocaine

Cocaine is a capably addictive stimulant medication. For a great many years, individuals in South America have bitten and ingested coca leaves which is source of cocaine, for their stimulant effects. In the mid-1900s, refined cocaine was the primary dynamic fixing in numerous tonics and elixirs created to treat a wide assortment of diseases and was even a fixing in the early plans of Coca-Cola. Prior to the advancement of manufactured specialists utilized cocaine for the relief of pain. However, examine has since demonstrated that cocaine is an effectively addictive substance that can change cerebrum structure and capacity whenever utilized over and over.

Functions of cocaine

It shows very quickly effect after a solitary portion and vanish inside a couple of minutes to 60 minutes. Limited quantities of cocaine for the most part make the person feel euphoric, enthusiastic, loquacious, rationally caution, and easily affected to sight, sound, and contact. The medication can likewise briefly diminish the requirement for sustenance and sleep. Some clients find that cocaine encourages them perform straightforward physical and scholarly assignments all the more rapidly, in spite of the fact that others experience the contrary impact.

Effect of cocaine on dopamine

Cocaine particles block the dopamine transporters which shut down the neuron's capacity to take-up the additional dopamine inside the synaptic parted. This outcomes in expanded degrees of the synapse dopamine present in the extracellular spaces among these neurons.

Answer details

Subject: Biology

Level: College

Key words

  • Cocaine
  • Functions of cocaine
  • Effect of cocaine on dopamine

Learn more to evaluate

brainly.com/question/12887489

brainly.com/question/10560288

brainly.com/question/12603071

7 0
3 years ago
Read 2 more answers
PLS HELP ITS DUE TODAY
Black_prince [1.1K]

Answer:

BENEFITS:

The Descriptive investigation is used to describe a natural system when nothing or very little is known about the system. Like observing a new specimen in the microscope and describing it by observing the specimen.

A comparative analysis is used to compare two or more variable in nature by collecting data like observing the different colors of the rocks. It provides the data to show the similarity and dissimilarity of the population.

The Experimental investigation is used where experiments are performed to test and answer the scientific questions. The advantage is that data can be used as evidence for future research.

LIMITATIONS:

<u>descriptive  method  of  investigation </u>

It cannot be used to correct variable or be used to determine causes and  effect  of  the  problem

<u>experimental  method  of  investigation </u>

It might create an artificial situation that do not always represent the real  life situation

<u>comparative  method  of  investigation </u>

It  is not easy to control other variables that might influence the study

<em>Ngl, I just copy and pasted these answers from another brainly question</em>

5 0
3 years ago
A jellyfish skelton is made up of fluid filled cavities surrounded by air
leonid [27]

Answer:

what is the question?

Explanation:

4 0
4 years ago
Other questions:
  • Why antibodies are considered specific responses to pathogens
    7·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The thermic effect of food ______________
    14·1 answer
  • What process do plants use to incorporate the sun's energy into an organic molecule?
    11·1 answer
  • Write the following as an algebraic<br> expression:<br> the product of 5 and b<br> What
    12·1 answer
  • Which of the following is NOT a necessary characteristic of life?
    5·2 answers
  • Which of the following diseases primarily affects children?
    5·2 answers
  • Select the correct answer. Stephan's mother cuts a twig from a rose bush and plants it in the soil. After a few days, Stephan ob
    9·1 answer
  • Label the 5 part of the water cycle
    7·1 answer
  • Plz help thank you!!!!!
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!