1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
atroni [7]
3 years ago
13

What organelle is attached to the Rough ER

Biology
2 answers:
EleoNora [17]3 years ago
7 0

Answer:

Ribosomes

Explanation:

aalyn [17]3 years ago
6 0

Answer:

The ribosomes.

Explanation:

You might be interested in
Water-molds are made up of
mamaluj [8]

Answer:

plasmodium slime as it makes the mold of water ast all time

3 0
3 years ago
Read 2 more answers
Leaves attach to stems at nodes; the spaces between the nodes are internodes<br> true or false
dalvyx [7]
I believe it's is true
6 0
4 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Explain why the change in the way that molecules of b globin interact with each other lead to the sickling of the red blood cell
Nataliya [291]

The sickle form of the hemoglobin gene is created when an adenine nucleotide is changed to a thymine. ... That single amino acid replacement in the -globin protein alters the shape and the chemistry of the hemoglobin molecule, causing it to polymerize and distort the red blood cell into the sickle shape.

5 0
3 years ago
Give the atomic number, electron configuration and the number of valence electron if the following elements:
marishachu [46]

Answer:

Atomic number: 13

Electron Configuration:[NE] 3s²3p¹

Valence electron: 3

5 0
3 years ago
Other questions:
  • Compare and contrast what happens in mitosis and meiosis and discuss the importance of each process to a living organism.
    14·1 answer
  • This primitive fish was the ancestor of land-dwelling tetrapods (amphibians, reptiles, mammals and birds), although fish of this
    6·1 answer
  • Why do you think that concerns about the environment did not emerge in marine science until the late twentieth century?
    9·1 answer
  • A population of deer is defined by _____.
    9·2 answers
  • Which is the correct response time to stimuli?
    8·1 answer
  • Consider the food chain of grass → grasshopper → mouse snake → hawk. About how much of the chemical energy fixed by photosynthes
    15·1 answer
  • Volcanoes release sulfur dioxide gas. Sulfur dioxide gas can lead to and air pollution.
    10·1 answer
  • Which balances the equation Mg + O2 → MgO?
    15·2 answers
  • A building project caused many small mammals and insects to leave an area. What effect could this have on plant reproduction in
    13·2 answers
  • PLEASE HELP BIOLOGY!! WILL GIVE BRAIN!!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!