1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
4 years ago
10

Which devices have you used today? Check all that apply.

Biology
2 answers:
Anika [276]4 years ago
7 0

Answer: computer, motor vehicle, television, and microwave.

Explanation: computer for work, car for groceries, tv for entertainment, and microwave for warming dinner.

pshichka [43]4 years ago
4 0
Cell phone and computer
You might be interested in
Interpret and explain this graph on photosynthesis
AlexFokin [52]

Answer:

This graph is showing how different rates of light intensity, environmental temperature, and Carbon dioxide affect the rate of photosynthesis. It looks like the greatest rate of photosynthesis has .13% Co2 at 30 degress celsius.

Explanation:

I was always taught that they y-axis is the dependent variable and going off that, all the other variables can be controlled and changed.

3 0
3 years ago
What is the microclimate of a hilltop like?
Scilla [17]
<span>A microclimate is the climate of a small area that is different from the area around it. It may be warmer or colder, wetter or drier, or more or less prone to frosts.Microclimates may be quite small – a protected courtyard next to a building, for example, that is warmer than an exposed field nearby.</span>
3 0
3 years ago
Read 2 more answers
What is a gene that has two positive transcription factors called
adoni [48]

Answer:

Transcription factors

Explanation:

They are part of the cell's core transcription toolkit, needed for the transcription of any gene. RNA polymerase binds to a promoter with help from a set of proteins called general transcription factors.

5 0
3 years ago
Describe how different types of models could be used to research a disease. Make a list of questions you would ask.
Leto [7]

Answer:

A disease model is an animal or cells displaying of the pathological process that are observed in the actual human or animal disease.

8 0
3 years ago
Read 2 more answers
What is a hominid? A)a family of tree-swinging monkeys B)a family of baboons C) a family of primates that include humans D) a fa
suter [353]

Answer:

the real answer is a family of bipedal primate.

4 0
3 years ago
Other questions:
  • The absolute magnitude of a star:
    6·2 answers
  • *<br> Ribosomes - What do ribosomes make?<br> -Cytoplasm<br> -Other organelles<br> -Proteins
    13·1 answer
  • ​constituents in foods may be cancer causing, cancer promoting, or protective against cancer.
    5·1 answer
  • • How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbari
    12·1 answer
  • Gloria, a student from a poor family, goes to a therapist for treatment of her test anxiety. Her therapist tells her that the an
    6·1 answer
  • HELP ASAP. PLEASE RN. TY.
    7·1 answer
  • Members of the phyla Cnidaria and Bryozoa both have a circle of tentacles, which they use for feeding. Besides the difference in
    6·1 answer
  • Indicate whether each of the following descriptions is true of microtubules (MT), microfilaments (MF), intermediate filaments (I
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which student identified the correct step and the result of that process?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!