1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
borishaifa [10]
3 years ago
11

10. What changes during a chemical reaction between two compounds?

Biology
1 answer:
nadezda [96]3 years ago
8 0

Answer:

I think it's chemical bonds I'm not of that helped

You might be interested in
Title study of anxiety treatment
slava [35]

Answer:

Treatments and Therapies. Anxiety disorders are generally treated with psychotherapy, medication, or both. Psychotherapy or “talk therapy” can help people with anxiety disorders.

Explanation:

6 0
3 years ago
Drag and drop each phrase under the phenomenon it describes.
lubasha [3.4K]

Answer:

El Niño: warms water

Both: Occurs in Pacific Ocean & impacts climate

La Niña: cools water

Explanation:

Just did it on edg, hope it helps!

6 0
3 years ago
Darwin suggested looking at a species’ close relatives to learn what its ancestors may have been like. how does his suggestion a
m_a_m_a [10]
Phylogenetic bracketing is a technique for surmising utilized as a part of organic sciences. It is to deduce the probability of obscure attributes in life forms in view of their position in a phylogenetic tree. One of the primary utilizations of phylogenetic sectioning is on wiped out creatures, known from fossils.
3 0
3 years ago
Read 2 more answers
In pea plants, yellow seeds are dominant over green seeds. What would be the
Liula [17]

Answer:

I think c if not im sorry

Explanation:

6 0
3 years ago
What does vitalism mean why don't scientist believe this theory anymore ( be specific) pleaseeeeee help me
Dima020 [189]
<span>the theory that the origin and phenomena of life are dependent on a force or principle distinct from purely chemical or physical forces.</span>. They don't believe in it anymore because it simply had to rely on to many factors that seemed unlikely.<span />
3 0
3 years ago
Other questions:
  • Which option gives an object's volume in SI units? PLEASE HELP​
    8·2 answers
  • A single pair of goldfish in a aquarium produced a large number of offspring.
    9·1 answer
  • Why is understanding the structure of DNA and how it is replicated important? List some technologies and practical applications
    8·1 answer
  • During gym class, Raul walks briskly for a half hour. Jenna decides to sprint and run the bleachers for the same amount of time.
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How does human evolution relate to the sensibility of disease
    6·1 answer
  • Producers transform light energy into chemical energy. True or false
    7·1 answer
  • The _____ theory suggests that favorable behaviors are passed down from generation to generation.
    15·2 answers
  • Which of the following is NOT a benefit of plant biotechnology
    9·1 answer
  • C6H1206
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!