1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kipiarov [429]
2 years ago
12

Which of the following has been used to explain why people are more likely to develop phobias of certain animals or situations,

such as snakes, heights, slugs, maggots, or cockroaches that were survival threats in our evolutionary history?
A. classical conditioning
B. biological preparedness
C. the biosocial developmental theory
D. operant conditioning
Biology
1 answer:
Rina8888 [55]2 years ago
4 0

Answer:

B. biological preparedness

Explanation:

You might be interested in
Introduced species often take over an ecosystem because they usually what?
Firdavs [7]
Have very few or no predators in the new ecosystem.
6 0
2 years ago
Read 2 more answers
Which of the choices below provide direct evidence of evolution
den301095 [7]
A and C


They both can be compared to present or past objects to show how they have changed or evolved over time
3 0
2 years ago
Read 2 more answers
One of the main sources of sediment in flowing water is
Dmitrij [34]
I think it is B  I had done these.
7 0
3 years ago
Read 2 more answers
2. A fruit fly is classified as a consumer rather than as a producer because it is unable to 1. reproduce asexually 2. synthesiz
Kisachek [45]

Answer:

2. synthesize its own food

Explanation:

Based on how they obtain their nutrition, living organisms has been classified to be either producers, consumers, or decomposers. Producers are organisms capable of synthesizing their own food using light (photosynthesis) or inorganic chemicals (chemosynthesis).

Consumers, on the other hand, cannot synthesize their own food and hence, rely on other organisms to obtain their energy source. Consumers feed on other organisms to obtain energy. In this question, a fruit fly is classified as a CONSUMER because it cannot synthesize its own food.

7 0
2 years ago
Read 2 more answers
When a ball at the top of a hill starts to roll down, what energy transformation occurs?
Harlamova29_29 [7]

Answer:C

Explanation:When the ball it up high it holds gravitational potential energy, as it rolls down it gain kinetic energy which is then turned into heat energy due to friction

5 0
2 years ago
Other questions:
  • Which of these sets of physical characteristics is used to classify animal groups
    8·2 answers
  • In a brain surgery that went wrong, matthew lost a portion of his _____ cortex and has blindness in part of his field of vision.
    8·1 answer
  • The Great White Shark is on its way to being endangered. Why? Cite your evidence to support your response.
    12·1 answer
  • What fills up the space inside a cell?
    8·2 answers
  • An apple appears red because it red wavelengths.
    6·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The ability to roll the tongue in humans is coded by the dominant allele R. The inability to roll the tongue is coded by the rec
    7·1 answer
  • What can be said about the leading versus the lagging strand in dna population?
    8·1 answer
  • The evolution of the heart from 2-chambers, to 3-chambers, to 4-<br> chambers allowed the animal to
    11·1 answer
  • Identify the tissues and write their main functions<br><br>9 to 11 carries three marks each​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!