TRUE. the placenta develops in the mother's uterus during pregnancy. The structure provides oxygen and nutrients to the growing baby and removes waste products from the babys blood
An example of an alternate path in the rock cycle could be sedimentary rock goes through melting and becomes magma.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
4-Growth, maintenance, balance fluids, maintain proper hp
2-Actin, collagen
<span>Rhabdomyolysis constitutes a common cause of acute renal failure and presents paramount interest. A large variety of causes with different pathogenetic mechanisms can involve skeletal muscles resulting in rhabdomyolysis with or without acute renal failure. Crush syndrome, one of the most common causes of rhabdomyolysis presents increased clinical interest, particularly in areas often involved by earthquakes, such as Greece and Turkey. Drug abusers are another sensitive group of young patients prone to rhabdomyolysis, which attracts the clinical interest of a variety of medical specialties.
We herein review the evidence extracted from updated literature concerning the data related to pathogenetic mechanisms and pathophysiology as well as the management of this interesting syndrome.
Keywords: Rhabdomyolysis, acute renal failure, myoglobin, crush syndrome
The first case of the crush syndrome, which constitutes one of the main causes of rhabdomyolysis, was reported in Sicily in 1908, after an earthquake1,2. In 1930, in the Baltic area, an epidemic of myoglobinuria was observed due to consumption of contaminated fish. Interest in rhabdomyolysis and crash syndrome was stimulated during the World War II particularly after the bombing in London, where the victims developed acute renal failure and myoglobinuria1.
Rhabdomyolysis is a rupture (lysis) of skeletal muscles due to drugs, toxins, inherited disorders, infections, trauma and compression3. Lysis of muscle cells releases toxic intracellular components in the systemic circulation which leads to electrolyte disturbances, hypovolemia, metabolic acidocis, coagulation defects and acute renal failure due to myoglobin4.
The skeletal muscle consists of cylindrical myofibrils, which contain variant structural and contraction proteins. Actin and myosin, arranged in thin and thick filaments respectively, form the repeated functional units of contraction, the sarcomeres5. The sarcoplasmic reticulum constitutes an important cellular calcium storage. It is structurally connected to the t-tubules, that are formed by invaginations of the muscle cell plasma membrane, the sarcelemma, around every fibril (Figure 1). After the sarcelemma depolarization, the stimulation arrives, through the t-tubules junctions, at the sarcoplasmic reticulum, inducing the calcium ions release and triggering muscle contraction6.</span>
