1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mash [69]
4 years ago
9

What happens in the G2 phase of the cell cycle?

Biology
2 answers:
balu736 [363]4 years ago
5 0
The Best Answer :
 <span>"G2 phase is the third, final, and usually the shortest subphase during interphase within the cell cycle in which the cell undergoes a period of rapid growth to prepare for mitosis. It follows successful completion of DNA synthesis and chromosomal replication during the S phase, and occurs during a period of often four to five hours. This far into interphase the nucleus is well defined, bound by a nuclear envelope and contains at least one nucleolus. Although chromosomes have been replicated they cannot yet be distinguished individually because they are still in the form of loosely packed chromatin fibers. The G2 phase prepares the cell for mitosis (M phase) which is initiated by prophase. 
At the end of this gap phase is a control checkpoint (G2 checkpoint) to determine if the cell can proceed to enter M phase and divide. The G2 checkpoint prevents cells from entering mitosis with DNA damaged since the last division, providing an opportunity for DNA repair and stopping the proliferation of damaged cells. Because the G2 checkpoint helps to maintain genomic stability, it is an important focus in understanding the molecular causes of cancer."</span>
yanalaym [24]4 years ago
4 0
<span>The G2 phase of the cell cycle is when the cell prepares for division, Mitosis. Mitosis is also part of the interphase of the cell cycle.</span>
You might be interested in
Correct information to tell the client who is taking theophylline would be
STatiana [176]
<span>C. avoid caffeine when using this oral medication: consuming caffeine would cause an overdose of the caffeine or similarly chemical compounds in the clients system due to the fact that theophylline is chemically similar to the family of caffeine products.</span>
3 0
3 years ago
Its energy source is glucose, which it is taking up from its environment via na/glucose symporters distributed throughout the su
-BARSIC- [3]
Considere la fórmula para la glucosa: C6H12O6<span>. </span>¿Qué indica esto acerca de la relación de los reactivos a la glucosa?<span>Doce agua (H2O) moléculas se utilizaron para hacerlo.</span><span>Doce de hidrógeno (H2) Se utilizaron moléculas para hacerlo.</span><span>Seis de oxígeno (O2) Se utilizaron moléculas para hacerlo.</span><span>Seis dióxido de carbono (CO2<span>) Se utilizaron moléculas para hacerlo</span></span>
4 0
4 years ago
8. What is a reactant in this formula? 6CO2 + 6H2O -------&gt; 6O2 + C6H12O6 *
joja [24]

Answer:

CO2 and H2O are the reactant in the given formula.

Explanation:

The chemical equation that is mentioned in the question is the reaction of photosynthesis. During photosynthesis process the atmospheric CO2 reacts with H2O or water to generate glucose(C6H12O6) along with the liberation of oxygen gas(O2)

    We all know that the substances those are present in the left side of a chemical or biochemical reaction are termed as reactant.

 From that point of view it can be stated that in the given reaction CO2 and H2O act as reactant.

6 0
3 years ago
How does sexual reproduction compare to DNA transfers in prokaryotes? (2 points)
Andreyy89

Answer:

The correct answer is b. I and II

Explanation:

Sexual reproduction is present in higher forms of life and absent in prokaryotes like bacteria. Sexual reproduction results in greater evolutionary changes due to the fusion of two different gametes from two different individuals of a species.

Therefore sexual reproduction helps in increased genetic diversity in higher forms of life. In prokaryotes like bacteria, genetic diversity is maintained and increased through DNA transfer from one bacterial cell to another with the help of a process known as horizontal gene transfer.

Bacteria have sex pilli which is used to introduce the genes to the other bacteria. By this process, they increase their genetic diversity and evolve continuously. So the correct is b. I and II.

7 0
4 years ago
How does the field of science gain knowledge and understanding
astraxan [27]

Science gains knowledge and understanding through the testing of hypotheses.

  • A hypothesis is a given explanation of a particular phenomenon from the real world, which is tested (i.e., either verified or rejected) by using the scientific method.

  • The scientific method is a methodology based on experimental and observational procedures that allow obtaining and interpreting empirical evidence.

  • Subsequently, the evidence obtained from experimentation and/or observation is assessed in order to accept or reject the working hypothesis.

Learn more in:

brainly.com/question/8169133?referrer=searchResults

6 0
3 years ago
Other questions:
  • Which of the following is a nonrenewable resource?
    5·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What are the eukaryotic cells ?
    8·2 answers
  • Which of the following is not one of the four main types of tissues? basement epithelial connective muscle
    5·1 answer
  • Plz help me What is the role of the major reservoirs in the water cycle
    10·1 answer
  • (-4) + (-4) + 6+6+5 + 5 ​
    7·2 answers
  • Define the photosynthesis?​
    13·2 answers
  • Which effect does fertilizer runoff have on North Carolina lakes and streams?
    15·2 answers
  • Which beaker shows hot water? A or B?
    10·1 answer
  • Ethical dilemmas raised by dna technology and knowledge of the human genome include?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!