Answer:Tay-Sachs is an autosomal recessive disease caused by mutations in both alleles of a gene (HEXA) on chromosome 15. HEXA codes for the alpha subunit of the enzyme β-hexosaminidase A. This enzyme is found in lysosomes, organelles that break down large molecules for recycling by the cell.

Explanation:

8 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

The Ring of Fire is a region of tectonic activity. This means that it is an area where __________ are especially common.

Andreas93 [3]

<h2>Answer:</h2>

<u>a. Earth quakes</u> are common.

<h2>Explanation:</h2>

"Ring of Fire" is a significant region in the bowl of Pacific Ocean where numerous earthquakes and volcanic ejections happen. In an enormous 40,000 km horseshoe shape, it is related to an about nonstop arrangement of maritime channels, volcanic circular segments, and volcanic belts and plate developments. It has 452 volcanoes.

About 90% of the world's tremors and about 81% of the world's biggest seismic tremors happen along the "Ring of Fire". The Ring of Fire is an immediate aftereffect of plate tectonics: the development and impacts of lithospheric plates, particularly subduction in the northern segment.

9 0

3 years ago

Read 2 more answers

Describe the two major types of active transport.

qaws [65]

The 2 major types are endocytosis and exocytosis.
Hopes this helps! ((:

4 0

4 years ago