1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
4 years ago
12

A patient approaches you yelling that their schedule appointment was at hour ago and they still haven’t been seen the angrily po

int their fingers as they complain that their boss will be furious if they are late back to work your goal is super individuation from escalating what should you avoid doing
Biology
1 answer:
Karolina [17]4 years ago
5 0

Answer:

anything that could escalate

Explanation:

what are the choices? i would think that you keep your temper very low do not raise your voice and try to get them into a seperate room so that you can try to calm them down

You might be interested in
Which of the following are examples of short-term, human-induced environmental changes? Select three answer choices
Rama09 [41]

Explanation:

we have mass Extinction deforestation and pollution

6 0
3 years ago
Read 2 more answers
This is information collected by observation or experimentation. It is recorded and analyzed by scientists.
natali 33 [55]
Data? is what i think would work
5 0
3 years ago
Read 2 more answers
Is it possible to find the same gene in two different kinds of organisms but not find the protein that is produced from that gen
Bingel [31]
Yes, quite frankly it is possible to find a same gene if you're in the same class of species, but finding the protein....I believe that's impossible because in every type of gene, you have the same proteins that make you function the same way. Without them you wouldn't be able to function properly.

If I found the same gene in all organisms that I've tested, I would be intrigued because that would be a giant step in evolution. My reason for this answer is because if you have the same gene that would technically mean we all specifically came from the same species of animals.

No, that's not true because other characteristics would eventually help us in many things, studies would help us get our brain much stronger and the intelligence level would be extraordinary.
6 0
3 years ago
How much does a blue whale weigh?
OlgaM077 [116]
Well, it depends but adults can weigh up to 420,000 pounds

5 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • If shale is exposed to the correct amount of heat and pressure what can it become
    9·1 answer
  • What is pollination?
    13·1 answer
  • The structure of molecules that make up proteins
    15·1 answer
  • The difference in elevation between the highest and lowest contour lines on a topographical map is called
    10·1 answer
  • Each of the following is a function of the integumentary system except:
    6·1 answer
  • When Jenner developed the first vaccine he was using the observation of milk maids who
    5·2 answers
  • What are the errors and explain why
    11·1 answer
  • 15. Which of the following are considered sources of "Chemical
    9·1 answer
  • Please help no links or ill report you
    11·1 answer
  • The cell is most active mitotically in the g phase
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!