1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
6

A gene is involved in promoting limb development in humans. The gene is initially weakly activated during the limb induction pha

se and then strongly activated during the progression phase of limb development. However, after limb growth ceases the gene is turned off. What type of histone modifications are associated with this gene during the different phases of development described above? Please discuss how genome organization would participate in regulating this gene. If this gene were inappropriately activated causing acancerous tumor, what would you classify this gene as and why?
Biology
1 answer:
Anna [14]3 years ago
8 0

Answer:

1. If the gene is weakly activated, it likely lacks repressive histone modifications, but may also lack the presence of histone marks associated with strong transcriptional activation such as acetylation.

When the gene is strongly activated, it likely lacks repressive marks (such as H3K9me2/3 and H3K27me3 - both examples of repressive histone methylation) and might possess some activating histone acetylation marks, such as H3K4ac, and active histone methylation such as H3K4me3

<em>An aside: The pattern and presence of different histone modifications would depend on the gene, but based on the fact that it is a developmental gene, I would assume that H3K27me3 and H3K4me3 are at play (these are part of the Polycomb/Trithorax system)</em>

<em />

After limb growth is complete, the gene is turned off. Repressive histone methylation marks would be associated with this state, such as the aforementioned H3K9me2/3 or H3K27me3.

2. Histone modifications are tightly linked to genome organisation. Histone methylation marks associated with repression such as H3K27me3 and H3K9me3 are associated with compact chromatin structures, which restrict the access of transcriptional machinery and other positive regulators. Conversely, histone marks associated with gene activation are associated with a more permissive chromatin environment that facilitates the binding of factors associated with gene expression. In the case of histone acetylation, the acetyl mark directly removes the positive charge of chromatin, relaxing its interaction with negatively charged DNA.

3. If the inappropriate activation of this gene caused a cancerous tumor, this gene would be referred to as an oncogene (or a proto-oncogene for the term before it is inappropriately activated).

Typically, there are two classes of genes that lead to cancer: tumor-suppressor genes and oncogenes. Tumor suppressor genes lead to cancer when their protective activity is reduced or demolished, leading to the production of cancer cells. Oncogenes lead to cancer when they become over active. Oncogenes are often genes associated positively with growth and proliferation, consistent with the gene in this example.

You might be interested in
Which of the following is TRUE about DNA?
Arturiano [62]

Answer:

a. DNA carries instructions for the functions of every cell and enzyme in living organisms.

b. DNA can serve as a way to identify one individual from another.

Explanation:

Which of the following is TRUE about DNA?

a. DNA carries instructions for the functions of every cell and enzyme in living organisms.

b. DNA can serve as a way to identify one individual from another.

c. All living organisms can carry DNA in practically every cell of their body

8 0
3 years ago
Read 2 more answers
Answer Explore It! #1 through #4 <br> Pls help me with this because I’m confused.
marta [7]

Answer:

<u>Explore It #1</u>

1) There are <u>12 consumers</u> in this food web.

2) This food web had <u>2 producers</u>.

<u>Explore It #2</u>

1) The Greenfly eats the berries. The berries are eaten by a grasshopper.

2) The snake eats the frog. The frog eats the grasshopper.

<u>Explore It #3</u>

1) The Frog eats a dragonfly.

   The Snake eats the frog.

   The Ladybug eats the greenfly.

<u>Explore It #4</u>

1) A snake eats a lizard. The Owl eats a lizard.

2) A shark eats a tuna. The Blue whale eats a group of krill.

<u>Give Brainliest if you please</u>

4 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Which person is most likely to cause a pandemic? one who had a cold and stayed at home one who was sick with the flu and flew to
Ivanshal [37]
Its the one with influenza that traveled to many different coultries
3 0
3 years ago
Read 2 more answers
Difference between diabetes mellitus and diuresis?? please help​
rodikova [14]

Explanation:

If you have been in EMS long enough, you may well have encountered a patient with diabetes insipidus. Like many, you may have assumed that it is a variant of the common disease diabetes mellitus. Actually, diabetes mellitus and diabetes insipidus are totally unrelated other than the name. The term diabetes is derived from Latin (originally Greek) and means “to go through or siphon,” referring to a large amount of urine produced by the kidneys. The term melitus, in Latin, means “sweet.”  

 

8 0
3 years ago
Other questions:
  • When describing a community a biologist would discuss every
    7·1 answer
  • What is the correct order of classification from largest (broadest) to smallest (most specific)?
    12·1 answer
  • What happens to cells when they contian lead?
    9·1 answer
  • __________________is the set of metabolic processes by which plants and animals convert the chemical potential energy in glucose
    5·1 answer
  • Consider Darwin's first writings on the theory of natural selection. An important point of Darwin's Essay on the Principle of Po
    13·2 answers
  • What happens to pyruvate molecules formed in glycosis in the absence of oxygen
    12·1 answer
  • What are two main processes of the oxygen and carbon cylcle
    6·1 answer
  • Biological washing powders contain protein-, fat- and carbohydrate-digesting
    15·1 answer
  • How does a stem cell become specialized into a heart cell?
    14·2 answers
  • Age why does the skeletal system become more brittle and susceptible to breakage?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!