1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lianna [129]
3 years ago
15

What happens during theCalvin cycle?​

Biology
1 answer:
stepan [7]3 years ago
4 0

Answer: The Calvin cycle has four main steps: carbon fixation, reduction phase, carbohydrate formation, and regeneration phase. Energy to fuel chemical reactions in this sugar-generating process is provided by ATP and NADPH, chemical compounds which contain the energy plants have captured from sunlight.

Explanation:

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
How can a pig oink? <br><br><br><br><br><br><br><br><br> Breathing?
Elodia [21]
Inhaling through the nose
4 0
3 years ago
Read 2 more answers
Can anyone say the answer ​
svet-max [94.6K]

Answer:

If you were to ask me I would say that your answer is C

Explanation:

5 0
3 years ago
Read 2 more answers
Breeding programs and habitat preserves have been established as an effort to protect the florida panther from extinction. studi
Inessa05 [86]
The answer is ‘panthers will become extinct due to the lack of genetic diversity’. The population will enter what is referred to an extinction vortex. This is when environmental, demographic and genetic factors interact and reinforce each other in a downward spiral of a species. The lack of genetic diversity in the population causes inbreeding and lack of diversity on which natural selection can act upon for the population to adapt.
6 0
3 years ago
Trout (fish) raised in cold water weigh more than trout raised in warm
alekssr [168]
<h2>Water temperature is the right answer</h2>

<h2>Hope it helps you Please mark me as brainliest.</h2>
6 0
2 years ago
Other questions:
  • As rock moves away from a mid ocean ridge it is replaced by
    10·1 answer
  • The process of _____________ occurs when the sending neuron normally reabsorbs excess neurotransmitter molecules.
    5·1 answer
  • To collect impressions found in dust, scientists use a device that:
    12·1 answer
  • In _______________________ both alleles are fully expressed in the individual.
    11·1 answer
  • NOT BIOLOGY ITS PHYSICAL SCIENCE how are the allotropes of carbon similar and how are they different?
    15·1 answer
  • The process by which organisms keep their internal conditions relatively stable is called
    9·1 answer
  • From which molecules are mRna created
    11·1 answer
  • Describe the characteristics of the phospholipid bilayer that permit small hydrophobic lipid molecules to pass directly across t
    12·1 answer
  • Which term BEST describes a gene?
    5·2 answers
  • What is the slowest moving weather front. Why<br> is it so slow?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!