1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8_murik_8 [283]
3 years ago
9

Resources a squirrel might need

Biology
1 answer:
tankabanditka [31]3 years ago
6 0
Basic needs? Like Food supply, water source, oxygen, safe environment like trees to hide from Predators.
You might be interested in
Describe how plants determine the name of a biome
scZoUnD [109]
Climate is the main factor is determining<span> which </span>plants<span> can grow in a certain area, which in turn defines the </span>biome<span>. Temperature and precipitation are the two most important factors that </span>determine<span> a region's climate.

</span>
3 0
3 years ago
Read 2 more answers
name the molecular bond present in carbohydrates that enables change in colour when using Benedict's reagent test​
Helen [10]

Answer:

<em>c</em><em>o</em><em>p</em><em>p</em><em>e</em><em>r</em><em>.</em>

Explanation:

<em>B</em><em>e</em><em>n</em><em>e</em><em>d</em><em>i</em><em>c</em><em>t</em><em>'</em><em>s</em><em> </em><em>s</em><em>o</em><em>l</em><em>u</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>i</em><em>s</em><em> </em><em>s</em><em>i</em><em>m</em><em>p</em><em>l</em><em>e</em><em> </em><em>c</em><em>a</em><em>r</em><em>b</em><em>o</em><em>h</em><em>y</em><em>d</em><em>r</em><em>a</em><em>t</em><em>e</em><em>s</em><em> </em><em>a</em><em>r</em><em>e</em><em> </em><em>h</em><em>e</em><em>a</em><em>t</em><em>e</em><em>d</em><em>,</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>s</em><em>o</em><em>l</em><em>u</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>c</em><em>h</em><em>a</em><em>n</em><em>g</em><em>e</em><em>s</em><em> </em><em>t</em><em>o</em><em> </em><em>o</em><em>r</em><em>a</em><em>n</em><em>g</em><em>e</em><em> </em><em>r</em><em>e</em><em>d</em><em>/</em><em> </em><em>b</em><em>r</em><em>i</em><em>c</em><em>k</em><em> </em><em>r</em><em>e</em><em>d</em><em>.</em><em> </em><em>t</em><em>h</em><em>i</em><em>s</em><em> </em><em>r</em><em>e</em><em>a</em><em>c</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>i</em><em>s</em><em> </em><em>c</em><em>a</em><em>u</em><em>s</em><em>e</em><em>d</em><em> </em><em>b</em><em>y</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>r</em><em>e</em><em>d</em><em>u</em><em>c</em><em>i</em><em>n</em><em>g</em><em> </em><em>p</em><em>r</em><em>o</em><em>p</em><em>e</em><em>r</em><em>t</em><em>y</em><em> </em><em>o</em><em>f</em><em> </em><em>s</em><em>i</em><em>m</em><em>p</em><em>l</em><em>e</em><em> </em><em>c</em><em>a</em><em>r</em><em>b</em><em>o</em><em>h</em><em>y</em><em>d</em><em>r</em><em>a</em><em>t</em><em>e</em><em>s</em><em>.</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>c</em><em>o</em><em>p</em><em>p</em><em>e</em><em>r</em><em> </em><em>(</em><em>I</em><em>I</em><em>)</em><em> </em><em>i</em><em>o</em><em>n</em><em>s</em><em> </em><em>i</em><em>n</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>B</em><em>e</em><em>n</em><em>e</em><em>d</em><em>i</em><em>c</em><em>t</em><em>'</em><em>s</em><em> </em><em>s</em><em>o</em><em>l</em><em>u</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>a</em><em>r</em><em>e</em><em> </em><em>r</em><em>e</em><em>d</em><em>u</em><em>c</em><em>e</em><em>d</em><em> </em><em>t</em><em>o</em><em> </em><em>C</em><em>o</em><em>p</em><em>p</em><em>e</em><em>r</em><em> </em><em>(</em><em>I</em><em>)</em><em> </em><em>i</em><em>o</em><em>n</em><em>s</em><em>,</em><em> </em><em>w</em><em>h</em><em>i</em><em>c</em><em>h</em><em> </em><em>c</em><em>a</em><em>u</em><em>s</em><em>e</em><em>s</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>c</em><em>o</em><em>l</em><em>o</em><em>r</em><em> </em><em>c</em><em>h</em><em>a</em><em>n</em><em>g</em><em>e</em><em>.</em>

8 0
3 years ago
Plz Help....
Thepotemich [5.8K]
Hi!! I was wondering if you could somehow include the graph for the first question, that would really help me in being able to help you!
3 0
3 years ago
I NEED HELPPPPPPPPP !!!!!!
lakkis [162]

Answer:

higher energy of reactants

3 0
3 years ago
Read 2 more answers
A blow to the cheek is most likely to break which superficial bone or bone part? (a) superciliary arches, (b) mastoid process, (
andrew-mc [135]

Answer:

The correct answer is option c, that is,<em> zygomatic arch. </em>

Explanation:

In anatomy, a section of the skull produced by the temporal bone’s zygomatic process and the zygomatic bone’s temporal process is known as the cheekbone or the zygomatic arch. Temporal bone refers to a bone, which protrudes frontward from the skull side, that is, over the opening of the ear, while the zygomatic bone is the lateral to the cheekbone.  

When a blow takes place to the cheek then the superficial bone or the part of the bone that breaks most likely is the zygomatic arch.  

5 0
3 years ago
Other questions:
  • Choose a symbiotic relationship from the list below. Research the relationship and write a 300 word report that includes the ben
    7·2 answers
  • What was the result when Morgan mated fruit flies with the genotype XrXr and XrY
    7·2 answers
  • Is it possible for one biome to change from one type to another?
    12·1 answer
  • It's easy points... to earn answer question :
    7·2 answers
  • How many chromosomes are in the skin cells of your body
    5·2 answers
  • After a game of football, David tries to calm down by relaxing in the swimming pool. He tries to get this breath back and relax
    14·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What is the scientific name of split?
    9·2 answers
  • With respect to the lobes of the brain, the frontal lobe is involved in ________ and the occipital lobe is the final destination
    9·1 answer
  • During alcohol fermentation what is converted into ethanol
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!