1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
4 years ago
12

If an inhibitory synapse fires at the same time and at the same distance from the initial segment as an excitatory synapse of th

e same intensity, what will be the effect on the membrane potential at the trigger zone? 1) an action potential will be generated 2) a sub threshold depolarization 3) no change 4) a subthreshold hyperpolarization
Biology
1 answer:
Sergio [31]4 years ago
6 0

Answer:

If an inhibitory synapse fires at the same time and at the same distance from the initial segment as an excitatory synapse of the same intensity there will be no changes in the potential in the firing zone.

Explanation:

Under normal conditions, the transmembrane potential depends on the ionic charges present in the intracellular and extracellular spaces. The extracellular space load is usually positive and in the cytoplasm is negative.

  • <u>Depolarization</u> occurs by opening ion channels that allow sodium to enter the cell, making the intracellular space more positive.
  • An opening of potassium channels releases this ion to the extracellular space, leading to <u>hyperpolarization</u>.

An excitatory synapse is one capable of depolarizing a cell and boosting the production of action potential, provided it is capable of reaching the threshold of said potential.

On the other hand, an inhibitory synapse is able to hyperpolarize the cell membrane and prevent an action potential from originating, so that they can inhibit the action of an excitatory synapse.

The interaction between two synapses, one excitatory and one inhibitory, -called synapse summation- will depend on the strength that each of them possesses. In this case, the intensity of both synapses being the same, there will be no changes in the membrane potential in the firing zone.

Learn more:

Excitatory and inhibitory postsynaptic potentials brainly.com/question/3521553

You might be interested in
The endomembrane system contains all of the following structures except the
lora16 [44]
Endomembrane system include: the nuclear membrane, the endoplasmic reticulum, theGolgi apparatus, lysosomes, vesicles,endosomes and the cell membrane.
8 0
3 years ago
Read 2 more answers
Compare and contrast the alpine and taiga biomes.
Simora [160]

Answer:

The alpine biome is found on five of the seven continents; the taiga biome is only found on three.  Both the alpine and taiga biomes have cold winters with temperatures below freezing and summers that are warm in comparison. The taiga biome has a much higher temperature range in the summer than the alpine biome.

5 0
4 years ago
How are the civic lives of average citizens and government related
Marysya12 [62]

Answer:

Civic The concept that civic communities benefit from the active engagement engagement of their citizens and that therefore civic communities have a responsibility to facilitate active citizenship and that citizens have a responsibility to participate actively in their civic communities.

Explanation:

7 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Which substance is absorbed in large quantities by rain forests? carbon dioxide acid rain ozone oxygen
almond37 [142]
The substance that is predominately absorbed in rain forests would be carbon dioxide, I believe. As many tropical trees are present and will uptake CO2 to synthesize glucose or sugar as a product of photosynthesis.
6 0
4 years ago
Read 2 more answers
Other questions:
  • Is there an advantage or disadvantage in knowing about the ocean floor landscape?
    6·1 answer
  • Water is traveling up a tree with nutrients so how does the water become ground water
    11·1 answer
  • Which of the following animals has a broad niche?
    7·2 answers
  • Digested starches, sugars, and proteins are absorbed by the?
    6·1 answer
  • What quantity can tell you whether a solution is acidic or basic?
    7·2 answers
  • The proposed kingdom Euglenozoa includes protists with one or two _____ emerging from an anterior pocket.
    12·1 answer
  • The energy in a sugar molecule is released through what
    10·1 answer
  • Please help me only if you really know i will mark brainly
    15·1 answer
  • Eukaryotic cells are somatic non-sex cells true or false
    14·1 answer
  • Please in question 13 its in the picture please whats the correct answers
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!