1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
3 years ago
13

Carolus Linnaeus Group of answer choices developed theories of natural selection. was a proponent of evolutionary change. establ

ished a binomial system of classification for plants and animals. was a supporter of Charles Darwin. opposed all notions of fixity of species.
Biology
1 answer:
padilas [110]3 years ago
3 0

Answer:

1- was a proponent of evolutionary change.  

2- established a binomial system of classification for plants and animals

Explanation:

Carolus Linnaeus was a Sweden naturalist that is considered to be the creator of the modern taxonomy. He created a dichotomic system to classify species, in which species are fixed entities without phenotypic modifications across time, this concept being contrary to Darwin's ideas. Linnaeus published his nomenclature botanical system in the book "Species Plantarum", which is nowadays a reference book for plant nomenclature.

You might be interested in
The nitrogenous base adenine can pair with, what?
svlad2 [7]
The nitrogenous base that pairs with Adenine is Thymine.
5 0
3 years ago
Read 2 more answers
By what process do glucose and fructose bond together to form sucrose (D)? What is the by-product of this reaction?
Lesechka [4]

Answer: dehydration synthesis; water

Explanation:

4 0
3 years ago
Read 2 more answers
Temperature in the tropics all year, whereas temperature at higher latitudes. Organisms that are physiologically adapted to cons
Reptile [31]

Answer:

May not

Explanation:

Adaptation is made possible as a result of an organism being exposed to different environmental conditions. These exposure makes it adopt different techniques for its survival which eventually results in it being adapted to the condition and is then passed on as traits to its offsprings. They are then able to survive when met with such environmental condition.

When an organism is exposed to the same conditions all the time then there is lack of genetic variation and adaptation may not occur.

6 0
3 years ago
10 branches of science first is definition of science
creativ13 [48]

Answer:

ham Bhan k Uthai xeya ta hamra Garmin lagai xa kathi la Kani k bara ma Pharo thanda lagai xai

7 0
1 year ago
"Antigenic Shift" is a characteristic of the causal agent of the Influenza. It is the result of a major change in the antigenic
gtnhenbr [62]

Answer:

True.

Explanation:

Antigen may be defined as the chemical that has the ability to evoke the  and immune response and can harm the living organisms. The specific antibody are produced against the immune response.

The antigens has evolved different mechanisms to prevent themselves from them the immune system of the host. The antigenic shift is the most common change that might occur in viruses that helps the antigen to protect itself by changing its genetic material. No anti viral drugs are available for the viruses.

Thus, the answer is true.

4 0
3 years ago
Other questions:
  • Omar's wife conceived a baby 7 days ago and does not yet know she is pregnant. his wife's pregnancy is currently in the:
    14·1 answer
  • What is the source of materials for volcanoes that erupt in both ways? how do you know? (10 points)
    11·1 answer
  • What type of ocean pollution is shown in the beach below?
    15·1 answer
  • _____ better mirrors the mitosis process.<br> Meiosis I<br> Meiosis II
    6·2 answers
  • Which of the following correctly compares steroid and nonsteroid hormones
    6·2 answers
  • Which organelle stores food
    5·1 answer
  • What is the flu pathogen?????????
    8·2 answers
  • The diploid number of chromosomes in a species is always what
    5·2 answers
  • Tropism is a plants growth in response to a stimulus, like light, gravity, and water. these growth responses are controlled by p
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!