1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klio [65]
4 years ago
5

Blood typing is based on the presence of proteins known as __________ on the outer surface of the red blood cell plasma membrane

. Blood typing is based on the presence of proteins known as __________ on the outer surface of the red blood cell plasma membrane. A.antibodies B.antigens
Biology
1 answer:
tensa zangetsu [6.8K]4 years ago
8 0

Answer: Option B) Antigens

Blood typing is based on the presence of proteins known as antigens on the outer surface of the red blood cell plasma membrane.

Explanation:

Blood groups A, B, AB, and O are determined based on the antigen-antibody reactions between donor and recipient bloods.

For instance,

- Blood type A has antigen A on its plasma membrane

- Blood type B has antigen B on its plasma membrane

- Blood type AB has both antigen A and antigen B on its plasma membrane

- while blood type O has neither antigen A nor B on its plasma membrane

So, antigens is the answer

You might be interested in
Farmers are excited to learn that scientists have discovered that if the Proton Pyrophosphatase pump is in an area where the con
zhuklara [117]

Answer:

scientist can use this information to grow crops with larger fruits and vegetables.

Explanation:

i had this question on USA test prep and i guessed because i couldn't figure it out and when i guessed i got it right because i chose B or what ever the answer choice is for the correct answer.

7 0
3 years ago
Read 2 more answers
This is the change in behavioral or feeding patterns by two or more competing populations to reduce interspecific competition.
algol13
Nice shift is the change in behavioral or feeding patterns by two or more competing populations to reduce interspecific competition. Interspecific competition is a type of competition between organisms of different species. A niche is a full range of physical and biological conditions in which an organism lives and the way in which the organism uses those conditions. 
7 0
3 years ago
Read 2 more answers
The reproductive structures used by cycads are called?
Lerok [7]
D. Cones
Cycads are basically composed of woody plants which have roots, a stem, leaves and reproductive structures called Cones. These cones differ from each other depending on the plant whether it is female or male. These cones vary from shape, size, color, etc. based on the sex of the plant.
8 0
3 years ago
A chloroplast is a plastid that uses light energy to initiate a reaction between carbon dioxide and water. The products of this
kirill115 [55]
It seems that you have missed the given options for this question, but anyway, the correct answer would be PHOTOSYNTHESIS. When a chloroplast uses light energy to initiate a reaction between carbon dioxide and water, the <span> products of this reaction are sugar and oxygen and the process that uses this function of a chloroplasts is photosynthesis.</span>
8 0
3 years ago
Could receiving extra chromosomes happen to the tasmanian devil? Why or why not?
Kazeer [188]

Answer:

Yes, extra chromosomes can be received by the tasmanian devil.

Explanation:

Extra chromosomes can be received by the tasmanian devil due to tumor disease in the tasmanian devil. In the beginning the old genome of tasmanian devil has 13 chromosomes but with the tumor disease, it receives one extra chromosome and completed 14 chromosomes. Tumor occurs when the dead cells are not removed from the body and the new ones are formed.

7 0
3 years ago
Other questions:
  • Using evidence from the text, describe the purpose of the cell membrane.
    14·1 answer
  • Which sentence best describes a cell that is isotonic for a substance?
    12·2 answers
  • What would happed to the amount and size of sediment carried by a stream if the velocity of the stream increased
    7·2 answers
  • BRAINLIESTTT ASAP!!
    6·1 answer
  • Any names of animals that start in letter "N"? any names of animals that start in letter "N"
    10·1 answer
  • Solutions hypertonic to bacteria and fungi are used for food preservation. For instance, jams and jellies are hypertonic with su
    10·1 answer
  • What would happen if a cell replicated once in the presence of this radioactive base?Suppose one were provided with an actively
    7·1 answer
  • Why are proteins considered organic molecules?
    5·2 answers
  • Enzymes often
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!