1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aneli [31]
3 years ago
9

There are few cells in the body that do not undergo mitosis: most somatic cells divide regularly, some more than others. Take fo

r example the cells that line the digestive tract. These cells must be frequently replaced because they are constantly eroded by the movement of food through the tract. What mechanism(s) is/are in place to ensure that these cells are exact copies of the mother cell
Biology
1 answer:
enot [183]3 years ago
7 0

mitosis causes the cells to divide making it a mother and daughter cell.

You might be interested in
Are plates the same as continents?
victus00 [196]

Answer:

No

Explanation:

The tectonic plates make up the earth's crust. Continents are huge visible land masses.

7 0
3 years ago
HURRY PLEASE!!BE QUICK!!What type of circuit is illustrated?
Anna [14]

it should be D.) hope the answer is right

8 0
3 years ago
Read 2 more answers
What is a compound calcium water air or iodine
vlabodo [156]
Water is the compound. Iodine and calcium are elements, and air is a mixture
5 0
3 years ago
I need help with these two questions
ahrayia [7]

Answer:

2.5 ft and 24 in cubed your welcome

Explanation:

:)

3 0
3 years ago
One difference between human cheek cells and onion cell is
gregori [183]
As in all animal cells<span>, the </span>cells<span> of the </span>human cheek<span> do not possess a </span>cell<span> wall. A </span>cell<span>membrane that is semi-permeable surrounds the cytoplasm. Unlike plant </span>cells<span>, the cytoplasm in an animal </span>cell is<span> denser, granular and occupies a larger space. The vacuole in an an animal </span>cell is<span> smaller in size, or absent.</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following statements are true about the impact of competition and environmental filtering on community structure. A
    8·1 answer
  • Why are palindromes important to genetic engineers
    14·1 answer
  • How are solar energy, the weather, and the water cycle related?
    13·2 answers
  • Given the central metabolite pyruvate (pyruvic acid), predict the types of metabolic products from aerobic respiration, anaerobi
    9·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The upper arm bone is the ______________
    10·1 answer
  • If one lesions the primary auditory cortex of a cat, the generalization gradient:
    15·1 answer
  • What statement best explains the change over the 10 year period?
    11·1 answer
  • fox's diploid number of chromosomes is 36. How would the number of chromosomes in the fox's body cells compare to the number of
    14·1 answer
  • A cross between a white horse and a brown horse produces offspring that are golden in color. The possible
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!