1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kari74 [83]
3 years ago
13

Name the type of microorganism which is described in the following passage: They are very small but they are not

Biology
1 answer:
Karolina [17]3 years ago
6 0

Answer:

Name the type of microorganism which is described in the following passage: They are very small but they are not  cells. They can only reproduce inside the cells of other organisms.

Viruses only reproduce inside cell and are very small also can not be seen with a naked eyes unless with a microscope

Explanation:

You might be interested in
A computer model is a ________.
rodikova [14]
A mathematical model
3 0
3 years ago
Read 2 more answers
What is product in biology
fredd [130]

Answer:a product consisting of a natural raw material; an unmanufactured product. Many primary products are exported for processing to the developed nations.

Explanation:

7 0
3 years ago
Which of these organelles is absent in a prokaryotic cell? ribosome nuclear membrane plasma membrane
aleksley [76]
<span> Some of the important features of a prokaryotic cell is that it contains a plasma membrane, ribosomes, and genetic material (DNA) that is not bound by a membrane. Therefore, prokaryotic cells lack a nuclear membrane. </span>
4 0
3 years ago
Read 2 more answers
Help Plz!!
lyudmila [28]
B.) A dog walks to a stream and drinks when it gets thirsty  

would have to be your answer..


8 0
3 years ago
Rivers deposit sediment. SC.912.E.7.7
Paraphin [41]

Answer: B

Explanation:

3 0
3 years ago
Other questions:
  • I am generally found both inside and outside of the nucleus in a eukaryotic cell! DNA RNA BOTH?
    7·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A social interaction in which both the donor's fitness and the recipient's fitness are increased is called
    6·1 answer
  • What is the most superficial layer of the skin that covers almost the entire body and protects deeper layers of skin?
    8·2 answers
  • In a hypotonic solution water moves _____ (in/out) of the Red Blood Cell
    8·1 answer
  • Molds and spores of fungus found in damp places, like basements or inside walls, can become toxic.
    14·1 answer
  • What kind of land feature is shown at point on this topographic map?
    11·2 answers
  • Nitrogen fixation is carried out mainly by...
    6·1 answer
  • The projections move the prokaryote through its environment is known as ribosome
    7·2 answers
  • Which of the following are resources that individuals of different species
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!