It helps classify animals according to their needs.
Hope this helps!
-Payshence xoxo
Answer:
A hydrocarbon is any of a class of organic chemicals made up of only the elements carbon (C) and hydrogen (H). The carbon atoms join together to form the framework of the compound, and the hydrogen atoms attach to them in many different configurations.
Hope this helps!
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
Gas exchange between tissues and the blood is an essential function of the circulatory. The air contains oxygen that crosses the lung tissue, enters the bloodstream, and the alveoli are in direct contact with capillaries of the circulatory system. As water flows over the gills, oxygen is transferred to blood via the veins.
Explanation:
Answer:
Yes
Explanation:
Experimental research includes the manipulation of control variables to measure its impact on the dependent variables.
Both groups are experimental because they both involve the manipulation of control variables. In the given experiments control variable is the light source and the dependent variables is the bending of plant. Both group 1 and group 2, manipulate the control variables that is light source from one direction and light source from direction showing the plant behaviour towards light.
