Answer:
Compound
Explanation:
It is a chemical compound because it is something composed of one or two elements.
Answer:
Please the explanation below
Explanation:
DNA synthesis occur at the S phase of the cell cycle in preparation for cell division. The process which is also known as DNA replication occur in 3 main stages namely:
- Initiation
- Elongation
- Termination
At the initiation stage, the double helix DNA structure is unwound by DNA helicase enzyme to form a Y shape structure known as the replication fork. A short pieces of RNA called primer then binds to 3' end of the DNA strands at the starting point of replication.
During elongation, an enzyme known as DNA polymerase adds bases to the primer in the 5' to 3' direction. This makes the replication of the leading strand to be continuous. RNA primer binds to the lagging strand at multiple regions and are replicated in short disjointed fragments known as okazaki fragments. This kind of replication is discontinuous.
Termination involves the unbinding of RNA primer by an exonuclease enzyme. The primers are then replaced by relevant bases. Proofreading of the newly synthesized strands takes place and the okazaki fragments are joined together by an enzyme known as DNA ligase. Telomerase enzyme then adds telomeres to the end of the DNA strands and each newly synthesized strand winds to its parent strand.
Answer:
C. Equus quagga burchellii
Explanation:
southern subspecies of the plains zebra. It is named after the British explorer and naturalist William John Burchell.
Hi there! The answer and explanation are below.
The advantage that wind and solar technology have over coal and oil is that they save the environment and require less money. Wind energy and solar energy is naturally generated. But, coal and oil needs workers and processing in factories. The gases these factories releass are toxic to the environment.
Answer:
Explanation:
The sequence recording the five amino acid is 5' CTA-ATC-AGA-CCG-TAC-CAT 3'
The template strand is the strand from which the mRNA is transcribed
ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT
The coding stranger has the same sequence as the mRNA except the replacement of T with U in the mRNA
TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA
b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'
c. N terminus Met-Val-Arg-Ser-Asp C terminus
d. The shine delgarno region is GGAGGA
e. This region functions as the mRNA binding site to the small subunit of the ribosome in the process of translation.
