1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
3 years ago
15

Mutations in dna found in which cells are most likely to have significant evolutionary consequences?

Biology
1 answer:
maksim [4K]3 years ago
6 0

Answer: Mutations in gamete cells.

Explanation:

Mutations in gamete cells, called germinal mutations, occurs in reproductive cells that fully develops to ovum and sperm. When a mutated sperm or egg cell (genetically altered) come together to form a zygote during fertilization, they pass down that mutation to their offspring and it stands a chance of being inherited by future generations. It is through random germinal mutations that evolution occurs.

You might be interested in
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Whag should a person eat if he wans a fasterst supply of energy​
Colt1911 [192]
Carbohydrates, they break down easily
6 0
3 years ago
Read 2 more answers
It produces 90 percent of oxygen in the atmosphere
VashaNatasha [74]

Please state your full question next time.

7 0
2 years ago
Read 2 more answers
Which phrase if placed by box x would correctly complete the flow chart below
Simora [160]
Can you provide more of the question so I can answer it?
8 0
3 years ago
Read 2 more answers
An air freshener can change the scent of a room by _____.
Eva8 [605]

diffusion. would be the best answer to use

5 0
3 years ago
Read 2 more answers
Other questions:
  • Can parent's go too far in supporting their children's dreams
    7·1 answer
  • The peppered moth population in a locality has light and dark moth varieties. What is the likely cause of a relatively lower pop
    10·2 answers
  • How does the contractile vacuole in a single-celled organism function to maintain homeostasis?
    14·2 answers
  • Are mackeral sharks alive today
    12·1 answer
  • Using the weather data seen in this map of a section of the English countryside, how would you describe the current weather?
    8·1 answer
  • The leaf-cutter ants do not feed on leaves. please select the best answer from the choices provided t f
    11·2 answers
  • Respiration is a way to release carbon back into the atmosphere. ___ removes carbon from the atmosphere.
    8·2 answers
  • Title study of anxiety treatment
    9·1 answer
  • Write down a mechanism for increasing genetic variation in BOTH eukaryotes and prokaryotes.
    10·1 answer
  • Describe the locations, functions, and hormones of the thyroid gland and parathyroid.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!