1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka57 [31]
3 years ago
6

Cultures of a bacterial species were incubated on the shelf of a refrigerator, out on a lab bench top. on the shelf of a 37" C i

ncubator, and on the shelf of a 50" C incubator. After incubation, there was no growth at 37°C and SO. C, very little growth out on the bench top, and abundant growth at refrigeration. What tem could be used for this species?
A. Halophile
B. Mesophile
C. Anaerobe
D. Psychrophile
E. Thermophile
Biology
1 answer:
Alika [10]3 years ago
3 0

Answer:

D. Psychrophile

Explanation:

A psychrophile refers to the microorganism that can grow well at 0°C. These microbes have an optimum growth temperature of 15°C or lower. They can tolerate a temperature maximum of around 20°C but show inhibition of growth above that temperature. Some of the examples of psychrophile are <em>Bacillus psychrophilus, Chlamydomonas nivalis</em>. Psychrophiles are naturally found in Arctic and Antarctic habitats. According to the given information, the culture of the bacterial species was able to grow well at refrigeration and therefore, they are psychrophile.

You might be interested in
A weather station on the top of a mountain reports that the temperature is currently 0°C and has been falling at a constant rate
Vitek1552 [10]
The rate that the snow is fallin at is 5c every hour, it states that there for you..?
4 0
3 years ago
Define meiosis, mitosis, and heredity
Korvikt [17]

Meiosis: A type of cell division that results in four daughter cells each with half the number of chromosomes of the parent cell, as in the production of gametes and plant spores.

<span>Mitosis:<span> A type of cell division that results in two daughter cells each having the same number and kind of chromosomes as the parent nucleus, typical of ordinary tissue growth.</span></span>

<span>Heredity: T<span>he passing on of physical or mental characteristics genetically from one generation to another.</span></span>

5 0
4 years ago
What is a degenerate male?
Morgarella [4.7K]
D. Males that only survive to produce sperm
7 0
3 years ago
Can anyone Help me please idk
devlian [24]
Region of the World                             Percentage    Value in Metric tons
North America                                          17                  23,332,500
Asia                                                          52                  71,370,000
Africa                                                          3                    4,117,500
Europe                                                     18                  24,705,000
Latin America and the Caribbean              8                  10,980,000
Oceania                                                  <u>   2</u>                <u>    2,745,000</u>
                                                               100                137,250,000

We multiply the 137.25 million metric tons by its percentage to get its equivalent value in metric tons.

Asia uses 71.37 million metric tons.

In making the bar graph, The vertical line will be the percentage and the horizontal line will be the region. Bars of each region should have different colors for easy identification. Spaces between bars should be present, so that the bar graph will not be confused with the histogram.
6 0
3 years ago
What causes cirrhosis of the liver other than alcohol?.
Sloan [31]

Answer:

Chronic hepatitis B and hepatitis D

4 0
2 years ago
Other questions:
  • Divide each flock's total pieces of food by 300, the total number of pieces of food eaten. ** multiply the food percentage for e
    10·2 answers
  • What is the purpose of woolite when extracting DNA?
    11·1 answer
  • What macromolecule cause hemophilia
    14·1 answer
  • Immunity that protects an entire species from infection is a type of
    6·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which of the following organisms in the soil food chain does not obtain energy directly from plants
    7·1 answer
  • 2. Fungi can act as decomposers in the environment. Why is this important?
    10·2 answers
  • 1. Melting ice caps can result in _____.
    13·2 answers
  • How does the cell wall serve a similar purpose in eukaryotic and prokaryotic cells ?
    7·2 answers
  • What is the answer to number 2??
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!