1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
8

How does an increase in cell volume impact the diffusion of materials through the cytoplasm?

Biology
1 answer:
emmasim [6.3K]3 years ago
3 0
Answer A is correct. Cells are limited in size because the larger the cell is, the longer it takes for materials to diffuse throughout.
You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Which is biotic? water temperature beeswax snow
Luden [163]
Bees wax is biotic. 

Biotic means something that is related to or resulted from living things. Bio means life. Bees wax are produced by honey bees. It comes from a living thing, thus, it is biotic.

Water, temperature, and snow are all abiotic. Abiotic means "no life" or nonliving. They are not derived from any living thing. 



8 0
3 years ago
Read 2 more answers
How Neurons Work (1 of 3): Neuron Structure and Resting Potential (BioFlix tutorial)?
fiasKO [112]

 A neuron is nerve cells that transfer information within the body, chemically over short distances, using electrical signals over long ones.

   As it turns out, most resting neurons are permeable to Na+ and CL- as well as K+. K+ will try to drag the membrane potential toward its (positive) equilibrium potential, while NA+ try to drag the membrane potential to its negative equilibrium potential.

The real membrane potential will be between NA+ and K+ of equilibrium potential<span>. However, it will be closer to the equilibrium potential of the ion type with higher permeability.</span>
6 0
3 years ago
True or False: One way to overcome the peak in an activation energy curve is to add a catalyst.
yulyashka [42]
I think it's True.. ((:
http://www.chemguide.co.uk/physical/basicrates/catalyst.html
That might help ^

5 0
3 years ago
In which type of molecule is the ratio of hydrogen to oxygen
svp [43]

Answer:

O carbohydrate

7 0
3 years ago
Read 2 more answers
Other questions:
  • Imagine that adeline is a 13-year-old girl growing up in america in the 1890s. What is adeline's most likely response to her exp
    13·1 answer
  • An increase number of mitochondria in muscle cells would enable an individual to obtain energy from cellular respiration at a fa
    6·1 answer
  • Can fatigue seriously impair driving ability.<br> a.no<br> b.yes
    12·1 answer
  • Which of the following are signs and symptoms of dengue fever
    10·1 answer
  • What is the species name of a cat?
    14·2 answers
  • What is the type of inheritance shown in the following pedigree? Blue represents no disease symptoms, pink represents having dis
    9·2 answers
  • I am leaving brainly so free 100 points! I am doing more these so, don't worry if you didn't answer first.
    10·2 answers
  • PLS answer I NEED HELP!!!!!!!!!!!!!!!!!!!!
    7·1 answer
  • What is the function of the structure labeled C in the diagram to the right? it is where water, dissolved substances, and urea a
    8·1 answer
  • A person has problems in keeping his body in a balanced position and cannot coordinate his
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!