1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OlgaM077 [116]
3 years ago
11

Macy is looking for groundwater. She will most likely find it _____. under a mountain in a desert with no plants below a layer o

f shale in an area with limestone deposits
Biology
2 answers:
Anestetic [448]3 years ago
8 0
The correct answer choice would be D) an area with limestone deposits
ExtremeBDS [4]3 years ago
3 0

Answer:  in an area with limestone deposits

Explanation:

Limestone is a carbonate sedimentary rock the main composition of the limestone is the calcium carbonate. It can be easily solubilize in water. The groundwater is the water reservoir which is found in the earth geosphere. The  water below the earth crust reaches through the tiny pores inside the underground soil aggregates, and rocks. The water accumulates as a reservoir is freshwater that comes from sources like river, lakes, ponds and river water. The groundwater can be most likely to be found below the limestone deposits as the limestone being a soft material gets easily solubilize by the water and hence, water from surface and subsurface regions makes it's way to the underground.

You might be interested in
If a scientist were to study the organisms in your ecosystem what questions might they ask
aliina [53]

Answer:

I would write a question about relationships between predators and prey of a given ecosystem.

Explanation:

An example question is:

a.) "Draw a predator-prey graph that shows the relationship between lions and zebras."

b.) "Explain the trends of the above graph with regard to increase and decrease of the prey of predators."

I hope that made sense :)

Good luck.

5 0
3 years ago
Read 2 more answers
In an ocean ecosystem, which is necessary to begin a food web?
vagabundo [1.1K]
I believe that phytoplankton is necessary to begin a food web
4 0
3 years ago
Read 2 more answers
Secondary endosymbiosis led to chloroplasts surrounded by two membranes.
Anna35 [415]
Answer: False
Hope this helps b
6 0
2 years ago
Why might it be important to use different models at different stages of an investigation.
Alecsey [184]
Because u might have made a mistake on the first investigation so u want to repeat it a few more times
6 0
3 years ago
Which trait is homozygous dominant <br> A- Aa<br> B- aa<br> C- AA
Lesechka [4]
The answer is C because dominant is the capital letters and homozygous means the same
4 0
3 years ago
Read 2 more answers
Other questions:
  • If the planet were to cool in the future, snow may begin to accumulate in the head of a glacier more rapidly than it would melt
    15·1 answer
  • 1. The water cycle is driven by the _______.
    10·2 answers
  • The portion of the membrane system In eukaryotic cells that is responsible for making liquids and breaking substance is the
    7·1 answer
  • A condition in which there is a lack of rhythm of the heart beat is:
    15·1 answer
  • One of the needs of today's taxonomy is:
    7·2 answers
  • This is page 130 To read
    12·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Mendel is considered the Father of Genetics. His famous pea plant experiments helped to formulate several laws in genetics that
    8·1 answer
  • Ill mark brain list plss help
    13·1 answer
  • Consequences of hiv on individual and community
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!