1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
What types of plants are better adapted to drier climate
Svet_ta [14]
Cacti and other succulents can adapt to dry climates. They are able to store water in their leaves, while others store water in the roots or trunks. The waxy cuticle helps prevent water loss.
4 0
3 years ago
According to the phylogenetic tree to the right A.An ancestor of Eubacteria B.Archaebacteria came from Eubacteria C.Animals gave
gregori [183]

Answer:

There is something wrong with this question.

Check and reword.

Explanation:

The Choices of answers need revision.

3 0
3 years ago
Which statement about organism classified in the same genus is true?
notsponge [240]

Genus represents taxonomic rank above species and below family. When organisms belong to the same genus, they must be of the same phyla, but may be in different species. In binomial nomenclature it is the generic name shared by the group of close relative.

7 0
3 years ago
Read 2 more answers
The neuron that transmits the impulse is called the
disa [49]

Answer:

1. Presynaptic cell 2. Postsynaptic cell and 3. Neurotransmitters

Explanation: Just did the assignment

7 0
3 years ago
The very rare Bombay blood phenotype in humans results in blood type O because of the lack of both the A and B antigens in indiv
madam [21]

Answer:

The probability that the child will have type blood B equals <u>3/16</u>.

Explanation:

<u>Available data:</u>

  • Individuals with the rare Bombay blood phenotype lack both the A and B antigens in individuals and/or are of hh genotype.
  • Cross between two parents that are both of I A I B Hh genotype

Cross: IAIB Hh    x    IAIB Hh

Gametes) IAH, IAh, IBH, IBh  

                IAH, IAh, IBH, IBh

Punnett square)        IAH            IAh         IBH         IBh

                   IAH      IAIAHH     IAIAHh    IAIBHH   IAIBHh

                   IAh       IAIAHh     IAIAhh     IAIBHh    IAIBhh

                   IBH      IAIBHH     IAIBHh     IBIBHH   IBIBHh

                   IBh       IAIBHh     IAIBhh      IBIBHh   IBIBhh

F1) Genotype

  •     1/16 IAIA HH
  •     2/16 IAIAHh
  •     1/16 IAIAhh
  •     2/16 IAIBHH
  •     4/16 IAIBHh
  •     2/16 IAIBhh
  •     1/16 IBIBHH
  •     2/16 IBIBHh
  •     1/16 IBIBhh

    Phenotype

  •     3/16 Blood type A
  •     6/16 Blood type AB
  •     3/16 Blood type B
  •     3/16 Blood type 0  
3 0
3 years ago
Other questions:
  • Juxtaglomerular cells of the juxtaglomerular apparatus secrete _______________ when _______________.
    8·1 answer
  • Water that has a very low pH can be collected from hot springs in the area of Glenwood Springs, Colorado. A low pH indicates whi
    11·1 answer
  • how do engineers use models and earthquakes simulations to test designs for earthquake resistant buildings and structure
    12·1 answer
  • 1. What kind of process would deposit a sandbar in a river: a constructive process or a destructive process?
    6·1 answer
  • Question 3.3. Which statement best explains how the structure of a starch molecule relates to the function of the molecule?
    6·1 answer
  • What is condensation
    9·2 answers
  • All cells in your body need a constant supply of energy to stay alive.
    9·1 answer
  • In what way would the lack of receptors for local paracrine signal molecules affect animal cells?
    10·1 answer
  • A B-cell uses its surface antibodies as receptors to attach to specific antigens before they are taken in. By what mechanism doe
    11·1 answer
  • An external or internal cue or combo of cues that produces a response is called? A) motive B) observation C) reaction D) stimulu
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!