1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
What happens to chromosomes during metaphase?
wel

Answer:

Hello,

I hope this helps!

chromosomes that carry genetic information align in the equator of the cell before they split off into two daughter cells

Explanation:

During metaphase, the chromosomes that carry genetic information align in the equator of the cell before they split off into two daughter cells with identical genetic material. Metaphase is the third stage of mitosis, which is a phase of the cell cycle where chromosomes in the nucleus are divided between two cells.

7 0
3 years ago
11. Look at the figure above. Which atmospheric layer has around 80 percent of the mass of the earth's atmosphere? (Hint: It's w
shepuryov [24]

Answer:c)

troposphere

Explanation:

Bz it is closest to plant

7 0
3 years ago
Read 2 more answers
Your favorite bench has 42 large sand dunes. wind erosion destroys 8 sand dunes and creates 13 new ones. how many sand dunes wou
makkiz [27]
I think the answer is 47 because 42-8 is 34 then 34+13 is 47
4 0
3 years ago
Read 2 more answers
What biological process converts organic carbon compounds (like glucose) into inorganic compounds (like carbon dioxide)?
Dafna11 [192]
I wanna say it is <span>C.) fossilization </span>
3 0
3 years ago
Whole milk should not be given to an infant until after?
inysia [295]
Doctors recommend that infants should not be given cows milk until at least 1 yrs old, and whole milk (specifically) until she/he is 2 year or older, due to allergies and iron-deficiency anemia.

More info can be found here: http://www.parenting.com/article/ask-dr-sears-cows-milk-for-babies
6 0
3 years ago
Other questions:
  • 1. number and variety of species on Earth
    5·2 answers
  • Recent research on biological factors in suicide has linked it to low levels of the neurotransmitter _______ in the brain.
    12·1 answer
  • Why does cancer make people sick?​
    14·1 answer
  • Nerve impulses leading to the brain carry information about cool temperatures on the skin. the nerve fibers sending these signal
    14·1 answer
  • The diversity of species in a community refers to the _____.\
    9·2 answers
  • Locations in California are warmest in summer because sunlight in summer is
    12·1 answer
  • Which of the following best describes the approach of being proactive in your healthy choices?
    15·1 answer
  • 1. If a DNA strand has 33 % cytosine what percent will be adenine?
    12·1 answer
  • Where can you get information about endangered species?​
    14·1 answer
  • if u go outer space shouldn't you not see anything because it black and when you look back why is there a glow on and around the
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!