1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
It’s easy to understand why multiple bands would be present in the lanes containing DNA that has been cut with restriction enzym
bulgar [2K]

Answer:

These bands represent different confirmation of DNA

Explanation:

pGLO DNA is a plasmid DNA that is used as a vector for genetic engineering. Plasmid DNA is found in supercoiled confirmation in vivo. The double helix forms extra twists to easily fit inside the cells. During isolation of plasmid from the cell, nicks can be introduced in the DNA due to harsh isolating methods or contamination by nuclease. As a result the supercoiled confirmation is changed into circular confirmation. It is bulkier than the supercoiled form and travels more slowly. When both DNA stands get cut at the same place, the DNA gets liner confirmation. In the end, supercoiled DNA runs the fastest on gel followed by linear DNA and then the circular DNA.

8 0
3 years ago
What is the raw material of evolutionary change?
lisov135 [29]
Mutations Are the Raw Materials of Evolution. A mutation is a change in the sequence of an organism's DNA. What causes a mutation? Mutations can be caused by high-energy sources such as radiation or by chemicals in the environment
8 0
3 years ago
Only 10 percent of the energy stored in an organism can be passed on to the next trophic level. of the remaining energy, some is
Anna [14]

The rest is eliminated as heat.

7 0
3 years ago
Read 2 more answers
Choose all the answers that apply. WILL GIVE BRAINLIEST
finlep [7]
Made of frozen gas. 
Rocky leftovers
Smaller than planets.
6 0
3 years ago
Read 2 more answers
What is a density dependent limiting factor that affects population size?
scZoUnD [109]

Answer:

Disease

Explanation:

In Ecology, certain factors that affect the size of a population can either be dependent on size or not. Density-dependent factors are those factors that affect population of organisms in dependence of how dense the population is. Examples of these density dependent factors are diseases, predation etc.

For example, a certain disease will spread faster among a population of organisms whose size is dense but slower in a scarcely densed population. Hence, disease as a factor is dependent on population size. Note that; Drought, Climate, and Natural Disasters will wipe out a population irrespective of its size.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Why is something like a cold, a condition that obviously affects homeostasis, not considered a disease?
    10·1 answer
  • By what mechanism does a diploid animal grow after fertilization?
    15·2 answers
  • Inside the uterus a baby is held within two membranes - the chorion and amnion, collectively known as the __________. The membra
    7·2 answers
  • A batch of food contaminated with botulism exotoxin, consumed at a family reunion by most of the members of a family, would be a
    9·1 answer
  • Which observation would most likely be made before an experiment?
    14·2 answers
  • Question 10 of 10
    13·1 answer
  • The Super-Volcano erupts in Yellowstone National Park. Lava, ash, etc. devastates 2/3 of the USA leaving newly cooled rock
    14·1 answer
  • Can someone please answer these two questions correctly? thank you so much!! ((:
    9·1 answer
  • The sequence of the mRNA that would result from transcribing a DNA template strand with the bases TACGCTAAT would be
    9·1 answer
  • An atom whose valence electrons conform to the octet rule is:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!