1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
All life must maintain an internal balance, despite environmental changes. This is called
AlladinOne [14]
The answer is homeostasis.
5 0
3 years ago
What are the roles of a catalyst in the energetics of a chemical reaction?
7nadin3 [17]

Answer:

The correct answer is: catalysts lower the activation energy of the reaction.

Explanation:

Catalysts are substances that in our bodies are commonly represented by enzymes (specialized proteins) and that are used in chemical reactions to speed them up.

In order to achieve this, catalysts lower the activation energy of chemical reactions, which is a value of energy that must be obtained for the reaction to actually happen.

Catalysts are constantly used in our bodies and are responsible for the proper functioning of every organ. These catalysts can be used over and over again because they are not consumed in the reaction.

4 0
4 years ago
If this strand of DNA were used, what would be the complementary DNA produced? TAC GG A. TAC GC B. ACG CC C. CGT AA
LuckyWell [14K]
Hey there!

<span>If this strand of DNA were used, what would be the complementary DNA produced?

Answer: ATG CC

Hope this helps
Have a great day (:
</span>
8 0
4 years ago
During exercise, the __________ use oxygen faster, so the _________ have to work harder.
Mrac [35]

A. lungs, muscles because I went through them one by one and that's the only one that makes sense to me

Hope this helped :D

6 0
3 years ago
Read 2 more answers
Sexual reproduction requires the fusion of_______or sex cells.
3241004551 [841]

gamete. its gamete. hope i helped

8 0
3 years ago
Read 2 more answers
Other questions:
  • Explain how drinking too much water can throw off the electrolyte balance in your blood. how does this imbalance specifically af
    14·1 answer
  • Which of the following practices can help control erosion?
    13·2 answers
  • Which two molecules are compounds? NaHCO3 , O3 , Cl2 , C8H18
    8·2 answers
  • He tube feet have a bulb-like structure at one end called the 7)__ and a 8) __ at the other end, which aids in the starfish's ab
    14·1 answer
  • WILL GIVE BRAINLIEST 80 PTS
    7·1 answer
  • How can several different mutations cause the same genetic disease?
    5·1 answer
  • How do geese respond to the ecosystem around them? (simple answer pwease)
    13·1 answer
  • When the golgi apparatus and the endoplasmic reticulum work together what are they refer as ?
    12·1 answer
  • DNA replication is a process that involves copying the DNA molecule if a single base was miscopied what would be a possible resu
    8·2 answers
  • Play the spectrogram at normal speed and slowed down. How many calls did the bats make?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!