1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
Which hip bone forms the superioir part of the pelvic girlde that extends upward from the acetabulum
Mars2501 [29]

The ischium bone forms the superior part of the pelvic girdle.

<h3>What is the structure of the pelvic girdle?</h3>

In the bottom region of the trunk, there is a bony structure known as the pelvic girdle that resembles a ring. It joins the lower limbs to the axial skeleton. There are two types of pelvises: the bigger pelvic and the lesser pelvis.

The pelvis is made up of two paired hipbones that are joined at the pubic symphysis in front and by the sacrum in back. Each hipbone is composed of three bones: the blade-shaped ilium above and to either side, which determines the hips' width; the ischium below, on which the weight is placed when sitting; and the pubis in front. Early in maturity, all three come together at a triangle suture in the acetabulum, the cup-shaped socket that connects to the head of the femur to create the hip joint.

Learn more about pelvic girdle here:

brainly.com/question/14465949

#SPJ4

3 0
2 years ago
(don't answer) ran out of time on test lol
Bingel [31]

Answer:

oof

Explanation:

8 0
3 years ago
Distinguish between the keywords "trait" and "allele".
Alex787 [66]
A trait is the organism's feature. So, a trait would be eye color. A phenotype would be hazel. An allele is a gene. It can be recessive or dominant.
8 0
3 years ago
Read 2 more answers
The cellular process of creating two new DNA molecules from one original copy is called replication. Which statement is the BEST
Anni [7]
DNA opens up and each strand is used as template for a new strand.
5 0
3 years ago
Read 2 more answers
A scientist is tracking an object orbiting the Sun that is found between Mars and Jupiter. Which additional feature can
larisa86 [58]

Answer:

The correct answer is actually B. Has an irregular shape.

5 0
3 years ago
Other questions:
  • Why do scientists refer to charles darwin’s ideas about evolution as the theory of evolution?
    12·1 answer
  • PLEASE HELP!!!!!
    8·2 answers
  • Describe the effect that exercise has on tidal volume, alveolar ventilation, and anatomical dead space compared to the resting r
    10·2 answers
  •  a type of blood test that measures the antigen compatibility of the organ being donated to that of the tissues of the recipient
    12·2 answers
  • Which best defines carrying capacity
    9·1 answer
  • Which of the following is true about photoreceptors?
    7·1 answer
  • We use heat and additional bacteria to make a cheesefrom yoghurt.
    11·1 answer
  • Upwelling or Biodiversity
    7·1 answer
  • Does someone know the answer for this question I do not know it.
    12·2 answers
  • Which of the following statements are true about air?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!