1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
Gary has a piece of diamond and a piece of graphite. He wants to test the hardness of these two minerals. When he rubs the diamo
lutik1710 [3]
C ) The diamond is harder than graphite !!
8 0
4 years ago
Read 2 more answers
Photosynthesis requires energy from the sun. The products of
Serga [27]

Answer

The answer is A I think...

6 0
3 years ago
The Great Pacific Garbage Patch will be difficult to physically clean up because _______.
Charra [1.4K]
Because it lies in international waters, no single nation is responsible for its creation, and filtering out all the plastic will also remove plankton.

Therefore, all of the above
8 0
4 years ago
Read 2 more answers
when considering maintenance of a healthy weight, nutrient needs are affected by affected by all of the following except. A. age
DedPeter [7]
The answer is B.race

7 0
4 years ago
Read 2 more answers
Among the bacteria and archaea, which process produces results that are most similar to the results of sexual production in euka
klemol [59]
Conjugation - this is when bacteria exchange genes among each other. Sexual reproduction is when genes from the male and female are fused to create a new diverse zygote. Bacteria can do a similar process by conjugation.<span />
7 0
3 years ago
Read 2 more answers
Other questions:
  • Hormones secreted by the adrenal cortex that help to maintain glucose levels in the blood are called:
    14·1 answer
  • Unlike a scientific theory, a scientific hypothesis describes an observed pattern in nature without attempting to explain it tru
    9·2 answers
  • #REPOST# Please answer now! &lt;3
    12·1 answer
  • 5.
    5·2 answers
  • State one reason why an individual’s pulse rate increased during exercise.
    10·1 answer
  • Explain the conditions under which the body would concentrate or dilute urine.
    14·1 answer
  • Which of the following structures is found in both plants and animals, and is correctly paired with its function?
    13·1 answer
  • Explain how trees can grow in a<br> boreal forest,
    14·2 answers
  • 100 pt questions biol​
    10·2 answers
  • The study of which structure was instrumental in the formulation of the modern cell theory?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!