1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
Cells often need to take in materials from their environment which are
ch4aika [34]

Answer:

With the concentration gradient through passive Transport

Explanation:

I haven't taken biology recently, but if I'm not mistaken, cells that use ATP can only passively do things.

8 0
3 years ago
Which of the following statements is/are incorrect? a) The epidural space is located between the dura mater and the vertebral ca
dsp73

Answer:

C

Explanation:

The meninges are the membranous tissues that cover the spinal cord and the brain, providing support and protection to these organs. They are of three layers.

A) The Dura mater

B) The arachnoid mater

C) The pia mater

The Dura is the outermost meningeal layer and lies directly under the vertebral column bones and skull. The subdural space is the space between the Dura mater and the Arachnoid mater.

The Arachnoid mater lies in the middle of the Dura and Pia mater. Under the Arachnoid layer is the subarachnoid space which contains the cerebrospinal fluid. The cerebrospinal fluid acts as a shock absorber and a cushion to the brain and spinal cord.

The Pia mater lies under the subarachnoid space and directly on the spinal cord and brain and is highly vascularised.

5 0
3 years ago
Read 2 more answers
What happens to energy as molecules are broken down into their different atoms?
ElenaW [278]
If the molecules are broken down into their different atoms that’s mean that the molecules are going fast or slow
5 0
3 years ago
What does invasive species mean
wolverine [178]
Invasive species" is defined as aspecies that is: 1) non-native (or alien) to the ecosystem under consideration and. 2) whose introduction causes or is likely to cause economic or environmental harm or harm to human health.
8 0
3 years ago
Read 2 more answers
Areas of the brain involved in memory are located most closely to areas of the brain responsible for our sense of
Arte-miy333 [17]
The answer to this question would be: smell

The sensory organ that catch smell is located in the nose and will send the signal into the olfactory bulb. The olfactory bulb is located in the bottom part of the brain, near the hippocampus(which was the center of memory), and amygdala (which was the center of emotion).
8 0
3 years ago
Other questions:
  • Cholera is a waterborne pathogen that causes severe gastrointestinal disease. The organism is a slightly curved, gram-negative r
    13·1 answer
  • Female cones produce what? Which contain eggs
    12·2 answers
  • Imagine you discover a yeast mutant that exhibits a general inability to grow and thrive compared to wild-type yeast. You predic
    13·1 answer
  • Why do organisms need nitrogen
    9·1 answer
  • For each phrase below, choose the most appropriate key term from the list above
    11·1 answer
  • Genetics Movie
    9·2 answers
  • 1. Regions of active cell division in plants
    11·1 answer
  • Without the __, a plant wouldn't have any pollen.<br><br> fruit <br><br> stamen <br><br> nectar
    14·1 answer
  • All cells come from living things. True or false?
    5·1 answer
  • Write the issues of digestive health mention briefly ​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!