1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
What is the role of RNA in protein production
Marina86 [1]

Answer:

Ribosomal RNA (rRNA) associates with a set of proteins to form ribosomes. These complex structures, which physically move along an mRNA molecule, catalyze the assembly of amino acids into protein chains. They also bind tRNAs and various accessory molecules necessary for protein synthesis.

Explanation:

7 0
3 years ago
Which statement about the polarity of DNA strands is true?A) The 3' end has a free OH groupB) The 5' end has a free OH groupC) T
aleksley [76]
I believe the correct answer would be C.) The 3’ end has a free phosphate group
8 0
3 years ago
Explain why proteins are considered polymers but lipids are not
hammer [34]

Answer:

Polymers are made from a chain of one similar subunit bound together in sequence. Proteins are made from polypepetide chains which are sequences of amino acid subunits. Another example of polymer is DNA and RNA made of nucleic acid subunits.

However, lipids do not have one similar subunit but rather variable ways in which the lipid chains can form. For example phospholipid unit is made of a phosphate molecule bound to a fatty acid chain and glycerol. A triglyceride is a subunit of glycerol bound to three fatty acids chains. Cholesterol is also considered a lipid but is made of carbon rings rather than chains. Lipids therefore cannot be referred to as a polymer.

LearnMore:

To learn more on polymers check out;

brainly.com/question/6368957

brainly.com/question/12296309

brainly.com/question/9154529

#LearnWithBrainly

3 0
2 years ago
Can someone help me with these 2 questions please ?!
Bess [88]

Answer:

1 pretty sure its A and 2 i think its B

Explanation:

7 0
3 years ago
Read 2 more answers
Students in a class recorded their resting pulse rates
chubhunter [2.5K]

Answer: (A)

Explanation: I’m smart

6 0
2 years ago
Other questions:
  • What happens when magma convection currents move in opposite directions?
    6·2 answers
  • What is the function of the Golgi apparatus?
    5·2 answers
  • Why are the oldest fossils found in the oldest rock layers?
    11·2 answers
  • It is common for creatures to be able to live in both the spray zone and low tide zone
    15·2 answers
  • What visual evidence is a sign of creep
    13·1 answer
  • PLEASE HELP I WILL MARK BRAINALISTTTT
    15·1 answer
  • How is an organism's ability to produce offspring affected by changes to a chromosome??
    7·1 answer
  • The reactions of glycolysis that are shared with those in gluconeogenesis (ie use the same enzymes) are those that: Are substrat
    5·1 answer
  • Name a daughter cell type formed by the meiotic division of gamete mother cells of X ?​
    11·1 answer
  • What does belive mean ? people
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!