1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
2 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]2 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
charisma has a goldfish she keeps in a tank. she planted several underwater plants in the bottom of the tank. how are the goldfi
Paha777 [63]

Both are made up of cells, charisma has a goldfish she keeps in a tank. she planted several underwater plants in the bottom of the tank.

<h3>How long do goldfish live for?</h3>

Goldfish have a lifespan Of about 10-15 years, with some sorts living up to 30 years when occupied with proper maintenance.

Thus, Both are made up of cells.

To learn more about goldfish click here:

brainly.com/question/1940313

#SPJ4

6 0
1 year ago
What does classify mean in scientific terms
marin [14]
It is considered to be the placing of similar objects into similar groups. In science, it usually is a part of taxonomy, and taxonomy is science of naming living things by putting them into categories. I hope I helped!
4 0
3 years ago
Make a prediction. which morphological character do you think will best reflect relationships among these plants- body morpholog
Bond [772]

Morphological character such as leaf, node density , bud number,etc. change in many plant species in response to factor such as light availability , soil compaction and organic matter removal.

Vegetative and reproductive characteristics are the two systems  are common to nearly all vascular plants and provide a unifying theme for the study of plants morphology. It is important for the role to identifying plants, classification is also done by knowing the morphology of the plants.

Morphology is to identify plants using morphological characteristics. Plants can be identifies by observing certain distinguishing morphological characteristics but some plants are closely relatable , by which it shown by the similarity of their flower structures.

To learn more about the Vegetative and reproductive here

brainly.com/question/1213600

#SPJ4

5 0
1 year ago
What would Iraq have to do in order to reach a zero growth rate? What kinds of challenges might the Iraqi government face in try
sertanlavr [38]

Answer:

Iraq will have to massively reduce the birth rate to achieve a zero growth rate. In the middle east, there is more sexual freedom which may cause sexual education to be useless. Iraqi government would most likely have to give widespread contraception to its citizens.They would either have to lower birth rates or increase death rates. It would be more practical for the Iraqi government to provide contraception's and sexual education among its citizens to decrease birth rates.

5 0
3 years ago
In sickle cell disease variation in one gene causes red blood to end or sickle this means the suckled cells ___
ivolga24 [154]
Your answer is actually idk
5 0
3 years ago
Other questions:
  • The best way to DESTROY harmful germs that may be present in meat is to:
    10·2 answers
  • During which process is mRNA converted into a sequence of amino acids for protein production?
    9·1 answer
  • True or False. Animals vary tremendously in structure. Nevertheless, they can be categorized into a few basic body plans based o
    10·1 answer
  • Explain how wastage of food and defosteration contributes to global warming
    9·1 answer
  • Dolly, a female domestic sheep, was the first mammal to be cloned from a fully differentiated cell, using the process of nuclear
    7·2 answers
  • In Japanese four o'clock plants red (R) color is incompletely dominant over white (R') flowers, and the heterozygous condition (
    8·1 answer
  • How does the virus use a host cell to make copies of itself
    10·1 answer
  • Can someone pls help me ​
    11·1 answer
  • Which of the following statements is true?
    11·1 answer
  • Low elevation and low latitudes result in ____________________
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!