1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
Determine the nature of the expression of the lacZYA genes, represented by L, and label each genotype as constitutive, inducible
VladimirAG [237]

Answer:

Explanation:

Symbol          Representation

I-                     laci mutant cannot bind to the operator

Is                    laci mutant always bind to the operator

OC                 Operator mutant that prevent repressors binding

F’                    the wild type operator, O+, and laci gene on a plasmid

L                     lacZYA genes

I+ O+ L+   Inducible

I+ OC L+   Constitutive

I+ OC L+, F’   Constitutive

I- O+ L+, F’   Inducible

Is O+ L+    no transcription

Is O+ L+, F’   no transcription

3 0
3 years ago
A lizard lies on a rock to raise its body temperature. this is called
KATRIN_1 [288]
Hi!

A lizard lies on a rock to raise its body temperature. This is called B. Ectothermy.
4 0
4 years ago
Read 2 more answers
Como se relaciona la analgesia congenita con el arco reflejo
a_sh-v [17]

Answer: Congenital insensitivity to pain is a condition that inhibits the ability to perceive physical pain. While A reflex arc is a neural pathway that controls a reflex. In vertebrates, most sensory neurons do not pass directly into the brain, but synapse in the spinal cord. This allows for faster reflex actions to occur by activating spinal motor neurons without the delay of routing signals through the brain.

Explanation: So I would believe so

8 0
3 years ago
Please help its 6th grade science
notsponge [240]

Answer:

CAR C

Explanation:

I think

4 0
3 years ago
Which statement best describes how a catalyst can speed up a chemical reaction? A) The catalyst makes lower energy pathways avai
melamori03 [73]

Answer:

A) The catalyst makes lower energy pathways available.

Explanation:

A catalyst is a substance which speeds up a chemical reaction without itself being used in the reaction. Activation energy is the thresh hold energy which is required to initiate a chemical reaction. In the absence of catalyst, the activation energy is high therefore reactions are slower. But, presence of catalyst lowers the activation energy required to initiate the reaction as a result of which the reaction gets an alternate energy pathway to proceed which is responsible for speeding up the reaction.

8 0
3 years ago
Other questions:
  • What is an atom!!!!!!!!!
    5·2 answers
  • What kind of cellular changes would be expected in oil-eating microbes moved from a warmer environment to the arctic?
    11·1 answer
  • List two ways to increase life expectancy
    7·1 answer
  • Which is the BEST description of a macromolecule?
    14·1 answer
  • Global warming can be attributed to the increase in greenhouse gases. Which of the following is a major greenhouse that gas huma
    14·1 answer
  • Which of these statements expresses a scientific theory?!
    5·1 answer
  • How are abiotic factors related to the biotic factors of an ecosystem
    12·1 answer
  • What protein looks looks like a cork screw?
    8·1 answer
  • I need this answer now pls help
    14·2 answers
  • Plants have structures that help perform many physiological processes that are required for the plant’s survival. Which of the f
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!