1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
Organisms at the first trophic level in a food pyramid are:
brilliants [131]

Answer:

The first and lowest level contains the producers, green plants. The plants or their products are consumed by the second-level organisms—the herbivores, or plant eaters.

Explanation:

3 0
3 years ago
How do cells combine and reproduce to create different combinations of DNA in babies?
zalisa [80]

Through the process of Meiosis

3 0
3 years ago
What must predators be able to do?
tatuchka [14]

Answer: Hunt and kill other organisms

Explanation:

A predator is a living organism usually animal, that is capable of hunting, killing and feeding on other organisms. The hunted animal is called a prey.

For example:

Lions, tigers, leopards all hunt for antelopes using their good eyesight to find them, their powerful claws to kill and their jaws to feed on its flesh.

Thus, lions, tigers and leopards are predators while antelopes are preys

3 0
3 years ago
Why ureolytic bacteria use urea? And why they produce CaCO3?
Mamont248 [21]

Answer:

Due to urease activity, bacteria are able to use urea as a sole nitrogen source and produce ammonia, which increases the pH in the proximal environment, causing Ca2+ and CO32- to precipitate as CaCO3.

5 0
3 years ago
Read 2 more answers
Please help me How do water particles in a wave move?
Anton [14]
Water waves are an example of waves that involve a combination of both longitudinal and transverse motions. As a wave travels through the waver, the particles travel in clockwise circles. The radius of the circles decreases as the depth into the water increases. The animation at right shows a water wave travelling from left to right in a region where the depth of the water is greater than the wavelength of the waves. I have identified two particles in orange to show that each particle indeed travels in a clockwise circle as the wave passes.
5 0
2 years ago
Other questions:
  • All the biological macromolecules contain Carbon, hydrogen and oxygen. However, most do not contain nitrogen. The category that
    15·2 answers
  • In a well-constructed essay, describe why biodiversity increased with the introduction of sea otters in California over the last
    9·1 answer
  • Which letter indicates the wavelength of the wave?
    12·1 answer
  • What tissues are in the respiratory system?
    12·1 answer
  • The appendages of cockroaches and turtles are modified for creeping movements, but their internal structures are completely diff
    13·1 answer
  • Offspring that result from crosses between true breeding parents with diffrent traits are
    6·1 answer
  • External respiration takes place in the _____.
    11·1 answer
  • Respiration requires _________,<br> which is a waste given off during photosynthesis
    6·1 answer
  • Besides antibodies _________ are made after an active immune response.
    10·1 answer
  • How does the sucrose molecule leave the body?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!