1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
Fungi cannot make their own food through photosynthesis. How do they take in nutrients ? A.Absorbing sunlight B.producing spores
erma4kov [3.2K]

Answer:

Fungi take in nutrients by C. absorbing nutrients. They suck up nutrients from decomposing matter.

6 0
3 years ago
Read 2 more answers
Which is the main source of money used to pay for public primary and secondary schools?
Scorpion4ik [409]
A. Cuz the school gets money from the state
8 0
3 years ago
Read 2 more answers
All of the following are conditions that organisms in a tidepool must withstand except
NeX [460]
 d bc (a b c  and d) r the same to make a tidepool
3 0
3 years ago
What weather conditions would exist in El Paso based on the weather map seen here?
leonid [27]

Answer:

Dry and hot

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the following are ALL
miss Akunina [59]
4, any other option is a mix between dna and rna, or describes rna
7 0
2 years ago
Other questions:
  • The cerebellar ________ receives somatosensory information and influences the vestibulospinal and reticulospinal tracts. dentate
    7·1 answer
  • Please help me!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    14·1 answer
  • During which process is the code on an mRNA strand read for a particular amino acid??
    15·1 answer
  • Third-class lever systems, like most skeletal muscles, enable great strength but sacrifice speed and distance of movement. Third
    11·1 answer
  • If you are experiencing winds that are described as "southerlies," the winds are flowing from which direction?
    10·1 answer
  • A species of frog slowly dies off because it cannot compete with the toads and lizards that share its ecosystem. This is an exam
    7·2 answers
  • Morbidity rate is an important parameter used by epidemiologists to measure disease. If there are 10 new cases of measles per 10
    5·2 answers
  • Suggest how a cell may vary the rate of an enzyme controlled reaction:<br> nt
    14·1 answer
  • What is the complementary strand for the<br> following strand?<br> ATGCCGT
    6·1 answer
  • Other kinds of white blood cell have a different way of killing
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!