1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
2 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]2 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
Anabolic steroids are hormones that affect muscle growth. Many athletes 2 points
pav-90 [236]

Answer:

It's true that anabolic steroids used by some bodybuilders and athletes contain testosterone or chemicals that act like testosterone. The difference is that doses used in testosterone replacement only achieve physiologic (natural) levels of hormone in the blood.

Explanation:

It's true that anabolic steroids used by some bodybuilders and athletes contain testosterone or chemicals that act like testosterone. The difference is that doses used in testosterone replacement only achieve physiologic (natural) levels of hormone in the blood.

3 0
2 years ago
What was the first cell viewed by the light microscope
Angelina_Jolie [31]
The first cell that was viewed by the light microscope was the oak bark.
6 0
2 years ago
Controlling the rates of transcription and translation is important in bacteria to avoid collisions between ribosomes and rna po
7nadin3 [17]

The right answer is 20 aminoacids per second.

Transcription is a mechanism for synthesizing RNA from DNA.

Translation is a mechanism for synthesizing a polypeptide sequence from mRNA by converting the nucleotide triplet (codons) to amino acids.

So if one amino acid corresponds to three nucleotides. The polypeptide synthesis rate should be 20 amino acids per second for 60 nucleotides per second.

3 nucleotides ==> 1 amino acid

60 nucleotides ==> 60/3 = 20 amino acids.

4 0
3 years ago
A box is sliding at constant velocity. The coefficient of friction between the box and the surface is 0.27. The push force on th
Georgia [21]
Jidihejkfdkljdn hope it helps
3 0
3 years ago
Based on the climograph of six specific biomes illustrated here, which of the following shifts in biomes and their specific ecos
MatroZZZ [7]
The answer is A. Coniferous forest
to temperate forest
7 0
3 years ago
Other questions:
  • A certain species of butterfly varies in color from white to dark blue. The birds found in the same area feed on the white or li
    12·1 answer
  • The heart is considered a/an _______ and the cardiac muscle that includes it is considered _______
    13·1 answer
  • Which type of anemia is a result of vitamin b12 deficiency?
    8·1 answer
  • What is the purpose of a flowers petals
    15·2 answers
  • DNA is copied during
    5·1 answer
  • What are the two ways that carbon enters into the atmosphere?
    14·2 answers
  • What main process in meiosis ensures genetic variation in the offspring
    15·2 answers
  • What do scientists on the Intergovernmental Panel on Climate Change (IPCC) predict will happen to the earth's average temperatur
    13·1 answer
  • Which layer is between the mesosphere and the inner core? (7 points)
    11·2 answers
  • In peas, purple flowers are dominant to white and tall plants are dominant to short. A white and short plant is crossed with a p
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!