1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
2 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]2 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
Explain why both arguments are valid in the scenario below.
klio [65]

Answer:

Both the arguments are valid.

Explanation:

Claire thinks enough food should should be produced for everyone, because the world's population is rapidly increasing. Don thinks the environment should be kept in mind, because our environment is getting ruined every second. Hence, both arguments are valid.

3 0
2 years ago
A 20 kg box has been lifted 0.7m. How much work has been done?
Serga [27]
The work done is 137 joules.

Lifting opposes the acceleration of gravity, which is 9.8 m/sec/sec.

20 x 0.7 x 9.8 = 137 J (kg-m2/sec2)

4 0
3 years ago
Which structure of a protein is an unfolded amino acid chain?
natta225 [31]
B. Secondary

Hope this helped!!
3 0
3 years ago
Read 2 more answers
Why does epithelial tissue require a connective tissue?
musickatia [10]
Epithelial tissue lacks blood vessels, and forms surfaces, it is always found right next to connective tissue.

7 0
3 years ago
________ are the simplest lipids but they may be a part of or a source of many complex lipids.
kirill115 [55]
Answer: fatty acids
6 0
2 years ago
Other questions:
  • The ability to _ is an adaption to avoid predators ?
    13·1 answer
  • A major problem caused by humans is the contamination and depletion of
    11·1 answer
  • HELP!! hehe sorry but I’m kind of going crazy so can anyone help?
    9·1 answer
  • Which of the following could cause a habitat change?
    8·2 answers
  • Sympathetic nerves may leave the spinal cord at which vertebra?
    11·1 answer
  • A pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance
    7·1 answer
  • What cellular function does the respiration rate represent
    11·2 answers
  • Why are carbon reservoirs important in the carbon cycle
    6·2 answers
  • *urgent* What is the genetic information called in Anaphase II? What is another source of genetic variation during metaphase I?
    12·1 answer
  • Which of the following statements are true about the homologous chromosomes of a pair?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!