1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
5

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Biology
1 answer:
drek231 [11]3 years ago
5 0

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



You might be interested in
When a stored memory is recalled, it passes from the _____ for use.
KATRIN_1 [288]
The answer to your question is c 
hope this helped

5 0
3 years ago
A ___ is a factor in an experiment that can be manipulated.
Scilla [17]
Variable would be the most logical
4 0
3 years ago
Hich physiologic change increases cardiac work but does not enhance cardiac output?
Ugo [173]

Increased afterload physiologic change increases cardiac work but does not enhance cardiac output.

<h3>What about cardiovascular system?</h3>
  • Heart and blood vessels, which make up your cardiovascular system, deliver oxygen and nutrition to your body's organs so they can function.
  • Blood vessels also transport waste such as carbon dioxide to be disposed.
  • Conditions affecting the heart or blood vessels are collectively referred to as cardiovascular disease.
  • It is frequently associated with atherosclerosis, an accumulation of fatty deposits in the arteries that increases the risk of blood clots.
  • The heart, blood arteries, and blood make up the cardiovascular system.
  • Its main job is to carry deoxygenated blood back to the lungs and to carry nutrients and oxygen-rich blood to all regions of the body.
  • The most typical cause of coronary artery disease is atherosclerosis, which is a buildup of fatty plaques in your arteries.
  • Atherosclerosis can be brought on by unhealthy lifestyle choices such smoking, being overweight, not exercising, and eating poorly.

Learn more about cardiovascular system here:

brainly.com/question/946975

#SPJ4

6 0
2 years ago
When blood glucose levels decrease, in between meals, during fasting or from starvation, increased levels of ________ help to in
JulijaS [17]

Answer:

B. Glucagon

Explanation:

Glucagon is a pancreatic hormone, secreted by the alpha cells of islets of Langerhans. Whenever the blood glucose level falls, glucagon is released to increase the blood glucose levels. This function of glucagon is quite opposite to the function of insulin and hence both are antagonistic hormones. Insulin reduces the blood glucose where as glucagon increases the blood glucose.

Glucoagon is large polypeptide of 29 amino acids. Since it helps in increasing the blood glucose homeostatic levels it is called as hyperglycemic hormone. It does so by stimulating certain processes such as:

- Stimulating Glycogenolysis i.e breakdown of glycogen to release more glucose from liver.  

- Stimulating Gluconeogenesis i.e. synthesis of glucose from non-carbohydrate sources like proteins.

- Glucagon inhibits the process of glycogenesis i.e. synthesis of glycogen, the storage form of glucose.

7 0
3 years ago
The consistent reduction in fitness (survival, reproduction, etc) in a population due to widespread non-random mating is called
igomit [66]

Answer:

Natural selection

Explanation:

Natural selection occurs when one allele (or combination of alleles of different genes) makes an organism more or less fit, that it is able to survive and reproduce in a given environment. If an allele reduces fitness, its frequency will tend to drop from one generation to the next.

4 0
3 years ago
Other questions:
  • A physiological ________ is a difference in chemical concentration, electrical charge, physical pressure, temperature, or other
    12·1 answer
  • "A young pregnant woman went to a childbirth class and the instructor informed them about strengthening the muscles of the pelvi
    12·1 answer
  • Why is resource management of forest important for economic
    7·2 answers
  • What are the anti-codon in number 2
    15·1 answer
  • What's a good study strategy for an AP Biology exam?
    11·1 answer
  • Why are all of us considered scientists to some extent?
    8·1 answer
  • Complete Homework Questions from Pages 340-350 of California Experience Biology the Living Earth
    9·1 answer
  • An engine can exert a force of 1 000 newtons. how fast can this engine accelerate
    9·1 answer
  • how does the differences in shape between the long bones and flat bones contribute to their different functions
    9·1 answer
  • What are the two major types of genes responsible for cancer? What are their normal function
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!