1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olasank [31]
4 years ago
13

A researcher was studying mutations in bacteria found a certain bacteria had

Biology
2 answers:
AVprozaik [17]4 years ago
8 0
Evolution of organisms
Yanka [14]4 years ago
6 0

Answer:

Evolution Genetics

Explanation:

Genetic evolution of living beings is the process of the disappearance or emergence of new species due to genetic variability. This process is very slow and can take up to thousands of years so it is difficult to keep up with the evolution process.

The research shown in the question above is an example of genetic evolution research. This is because antibiotics are substances that have the power to kill any kind of bacteria, however some bacteria evolve, new species of bacteria have emerged that have the ability to resist and survive the action of antibiotics.

You might be interested in
1. Muscles require a lot of Oxygen to do their work?TRUE OR FALSE
Nitella [24]

Answer:

false

Explanation:

they can use lactic acid to anaerobically respire

3 0
3 years ago
Read 2 more answers
HELP!!!!!!!!!!
Andru [333]
Energy is the ability to do work which is stored in the body inform of ATP (adenosine triphosphate). ATP is comprised of a base Adenine, a ribose sugar (5 carbon sugar) and three phosphate groups. when a bond is broken energy is released and when a bond is formed energy is stored. ATP is used by cells as a source of energy such that ATP can easily release or store energy by breaking the chemical bonds and reforming the bonds between its phosphate group. The correct answer is c, phosphate- phosphate bond
6 0
4 years ago
A fruit fly population has a gene with two alleles, A1 and A2. Tests show that 70% of the gametes produced in the population con
IceJOKER [234]

Answer:

Option C

Explanation:

Given ,

A1 allele is carried by 70 % people

Let us assume A1 s dominant genotype

This means p= \frac{70}{100} = 0.7

Thus, frequency of allele in the given population is 0.7

It is also given that the population is in Hardy-Weinberg equilibrium thus

p+q=1\\0.7+q=1\\q = 1-0.7\\q= 0.3

Frequency of fruit fly with genotype A2A2 will be

q^2\\= (0.3)^2\\= 0.09

As per Hardy-Weinberg's second equation of equilibrium

p^{2} + q^{2} + 2pq = 1\\0.49+0.09+2pq = 1\\2pq = 1-0.49-0.09\\2pq= 0.42

Hence, option C is correct

7 0
3 years ago
What structure forms from the remnants of the follicle following ovulation?
joja [24]

Answer:

Corpus Luteum

Explanation:

Corpus luteum is a form of  endocrine structure in female ovaries which involved in the production of  high levels of progesterone in women. The progesterone is the one that regulate women's sex hormone, menstruation, and pregnancy.  Progesterone often used as a medication to combat early symptoms of menopause.

6 0
4 years ago
Suppose an explorer discovered a unique new species of plant and collected a sample for analysis by a geneticist. The geneticist
adoni [48]

my brain can't process this lol

6 0
3 years ago
Other questions:
  • In a cross between two true-breeding parents that both exhibit the dominant phenotype, ___ percent of the offspring will exhibit
    6·1 answer
  • What is the fossil record​
    15·2 answers
  • 4.
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • If one amino acid in a protein sequence is changed, what could happen?
    11·2 answers
  • Explain how different parts of a human being work together in unison. Use evidence from the text to support your answer.
    9·1 answer
  • What is a Phenotype ​
    14·2 answers
  • Use what you know about DNA to predict some of the physical properties of DNA that you will observe.
    9·1 answer
  • Name the major muscles
    11·1 answer
  • Multiple choice please help!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!