Answer:
1. Prophase
2. Chromosomes
3. Metaphase
4. Cell
5. Centrosomes
6. Anaphase
7. Duplicated chromosomes
8. Telophase
9. Membrane
Explanation:
This question is describing the process of mitosis which consists of four stages namely: prophase, metaphase, anaphase, and telophase etc.
- PROPHASE is the first stage of mitosis where DNA condenses down into CHROMOSOMES, and the duplicated separate.
- METAPHASE is characterized by the lining up of sister chromatids at the CELL PLATE through a push and pull motion as they connect to the microtubule spindle fibers emanating from the CENTROSOME.
- ANAPHASE is the third stage of mitosis in which DUPLICATED CHROMOSOME/SISTER CHROMATIDS are pulled apart into opposite poles.
- The fourth stage is TELOPHASE where the NUCLEAR MEMBRAN starts to reform and the DNA de-condenses.
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Answer:
The heartworms that can accumulate within the hearts of dogs and other mammals have a pseudocoelom, an alimentary canal, and an outer covering that is occasionally shed. To which phylum does the heartworm belong?
protozoa
Explanation:
Protozoa contain parasites that are habor by mammals as their host
The answer is option C "Warm air rises as cooler, denser air falls." Convection is heat transfer between two objects for example a hot metal pot to a spoon. During convection hot air rises and cold air (or denser air) sinks.
Hope this helps.
