1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GrogVix [38]
3 years ago
11

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Biology
1 answer:
Leya [2.2K]3 years ago
8 0

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

<h3>What is a sense DNA strand?</h3>

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

brainly.com/question/1048150

You might be interested in
Identify the products of photosynthesis. carbon dioxide and glucose glucose and oxygen carbon dioxide and water light energy and
Eva8 [605]

Answer:

0.17 mole of glucose is formed.

Explanation:

Step 1:

The equation for the reaction. This is given below:

CO2 + H2O —> C6H12O6 + O2

Step 2:

Balancing the equation.

The equation can be balanced as follow:

CO2 + H2O —> C6H12O6 + O2

There are 6 atoms of C on the right side and 1 atom on the left side. It can be balance by putting 6 in front of CO2 as shown below:

6CO2 + H2O —> C6H12O6 + O2

Therefore are 12 atoms of H on the right side and 2 atoms on the left side. It can be balance by putting 6 in front of H2O as shown below:

6CO2 + 6H2O —> C6H12O6 + O2

There are a total of 8 atoms of O the right side and a total of 18 atoms on the left. It can be balance by putting 6 in front of O2 as shown below:

6CO2 + 6H2O —> C6H12O6 + 6O2

Now the equation is balanced.

Step 3:

Determination of the number of mole of glucose (C6H12O6) produced by 1 mole of water.

This is illustrated below:

6CO2 + 6H2O —> C6H12O6 + 6O2

From the balanced equation above,

6 moles of H2O produced 1 mole of C6H12O6.

Therefore, 1 mole of H2O will produce = 1/6 = 0.17 mole of C6H12O6.

7 0
3 years ago
Having chromosomes that contain an identical pair of genes for a particular trait
Lubov Fominskaja [6]

homologous chromosomes

4 0
3 years ago
6 character traits for paul revere
Korolek [52]
Skillful 
diligent 
prideful 
responsible 
courageous 
daring 

3 0
4 years ago
Read 2 more answers
A student was observing slides of cell division. In one of the slides, he noticed loosely coiled chromatin depicting DNA duplica
soldi70 [24.7K]

Answer:

A. S phase

Explanation:

The cell cycle involves all the series of division events that occurs to an organism. Cell division, which can be meiosis or mitosis, involves two main stages viz: Interphase and M phase.

Interphase describes the resting stage of the cell i.e. when the cell is not dividing. The cell uses this time to prepare itself for the next round of division. Interphase stage further consists of three main phases viz: G1, S and G2 phases.

In the S phase or synthesis phase of Interphase, the cell duplicates its genetic material (DNA). Hence, an onion cell observed by a student to have loosely coiled chromatin depicting DNA duplication is in the S-PHASE.

6 0
3 years ago
Explain the role of light in photosynthesis. what is the photoelectric effect?​
VikaD [51]

Answer:

Explanation:

The photoelectric effect is a phenomenon in which electrons are emitted from matter (metals and non-metallic solids, liquids, or gases) after the absorption of energy from electromagnetic radiation such as visible light. One example of the photoelectric effect of light can be seen with zinc

7 0
3 years ago
Other questions:
  • Help ASAP . the growth of the plants that reindeer used as food could not keep up with the needs of the reindeer population. wha
    5·1 answer
  • Meningitis is the inflammation of the protective covering of the meninges. Which organs would be affected first by the condition
    5·2 answers
  • In humans, slow fibers are not found in the muscles of the
    5·1 answer
  • Which adaptation is used by polar bears to maintain internal homeostasis in cold temperatures?
    6·2 answers
  • How is diversity related to changes in ecosystem?
    7·1 answer
  • What are values?<br> (sociology)
    12·1 answer
  • Myostatin is and example of
    7·1 answer
  • The dermal layer is blank layer of the plant
    14·2 answers
  • DNA is made of nucleotides (one nucleotide is labeled X in the picture
    8·1 answer
  • Section II: Data and Analysis
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!