1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GrogVix [38]
3 years ago
11

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Biology
1 answer:
Leya [2.2K]3 years ago
8 0

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

<h3>What is a sense DNA strand?</h3>

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

brainly.com/question/1048150

You might be interested in
Are those considered theories?
Gnesinka [82]

Answer: yes

Explanation: because  In common parlance, theory is often used to refer to something that is rather speculative.

<h2>HOPE THIS HELP</h2>

7 0
3 years ago
Which of the following statements about oceans is true?
Basile [38]
I think the answer is A but i am not sure 
6 0
3 years ago
True or False? Many eukaryotes live in harsh environments, such as hot springs
liberstina [14]
True true true true true
4 0
3 years ago
Read 2 more answers
What kinds of molecules allow interactions between cells &amp; the matrix?
scZoUnD [109]

Answer:

adhesion molecules

Explanation:

Cells of multicellular organisms are organized into tissues and organs. This arrangement depends largely on your ability to adhere well to the extracellular matrix or other cells. In animal tissues, adhesion is carried out by means of the so-called adhesion proteins, which are anchored to the plasma membrane. These proteins have enabled the formation of animal bodies, all of them multicellular. In fact, the adhesion molecules of the various groups of animals, including marine sponges, are very similar to each other. <u>The adhesion not only serves to anchor and position the cells to form three-dimensional scaffolds, but also as a form of cellular communication that is to say allows the interaction between the cell and its matrix</u>. That is, the degree of adhesion and to whom the cells adhere is a type of useful information for the cell.

Adhesion also helps cells move through tissue or between tissues. Keep in mind that cells do not travel by swimming but by crawling. Therefore, to move the cells they need to first lose the adhesion that keeps them fixed and then expose other molecules that allow to create anchor points and drag the cytoplasm in the direction of movement. It is interesting that in some circumstances, such as during embryonic development, cells move in groups in a coordinated manner, for which cell-cell adhesions are necessary.

Adhesion proteins are arranged on the cell surface, being able to diffuse laterally through the membrane. When they bind to an extracellular molecule they are anchored. Individually, the force with which they adhere is not very great but since they are many molecules they generate a strong adhesion acting as a Velcro. Some of the adhesion molecules can interact laterally with each other, and with other proteins, to form groups that increase adhesion strength at certain points on the cell surface forming focal junctions and binding complexes.

6 0
4 years ago
Which molecule is the largest role in plant phototropism
zmey [24]
The correct answer for this question is this one: "D.) chlorophyll"Phototropism by definition is the orientation of a plant or other organism in response to light. It can either be toward the source of light ( positive phototropism ) or away from it ( negative phototropism ).Hope this helps answer your question and have a nice day ahead.
4 0
3 years ago
Other questions:
  • When you catch a cold, it is most likely you contracted it from _____.
    15·2 answers
  • What is a common term for cancerous cells that have spread in the body?
    9·2 answers
  • True or False? A plant can grow towards or away from a stimulus. When it grows towards the stimulus, it is called a negitive tro
    9·1 answer
  • Which instrument has to played sitting down? *<br> Bassoon<br> Clarinet<br> Oboe<br> Saxophone
    14·1 answer
  • Explain two positive environmental impacts of composting.
    13·2 answers
  • For the following, match the appropriate drug or drug class to its correct action. Choose the best answer for each. Symlin metfo
    7·1 answer
  • What are chloro-fluoro carbons ??<br>explain !!! ​
    12·1 answer
  • With the knowledge on the metabolism, describe this picture.​
    12·1 answer
  • Can someone help me please !
    5·2 answers
  • A scientist who wants to study the effects of fertilizer on plants sets up an experiment. Plant A gets no fertilizer, Plant B ge
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!