Question

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Answer 1

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

brainly.com/question/1048150