1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxx [7]
4 years ago
13

What does the scientific method help test in environmental science?

Biology
2 answers:
nataly862011 [7]4 years ago
5 0

Answer:

it helps come up with a conclusions for variety of hypothesis that are created when studying environmental science. the scientific method is a way to test a hypothesis

Umnica [9.8K]4 years ago
3 0

Answer:

The scientific method helps to test hypotheses in environmental sciences.

The scientific method is a way to test a phenomenon and gain a better understanding of the world.

Explanation:

The scientific method is a set of steps that must be followed in a scientific experiment to test hypotheses about a phenomenon that occurs naturally on our planet. This method allows the cinetistas to observe the phenomenon in a coherent and correct way, allowing a greater understanding of the world in which we live.

The steps present in the scientific method are: observation of the phenomenon, creation of hypotheses, experimentation (where hypotheses are tested), data collection, interpretation of results and conclusion.

You might be interested in
Which statement best describes the structure of a chromosome?
Pie

Your best bet is most likely going to be B

A Chromosome holds part or all of the genetic material of an organism. It also  includes packaging proteins which, aided by chaperone proteins, bind to and condense the DNA molecule to prevent it from becoming an unmanageable tangle.

So yes your best bet is B.

3 0
4 years ago
The genetic code is essentially the same for all organisms. From this, one can logically assume all of the following EXCEPT: A)
GuDViN [60]

Answer: DNA was the first genetic material.

Explanation:

The genetic code is essentially the same in all the organism. This states that the similar organism can have similar genes in them that codes for the similar proteins hence, called as similar organism.

The genetic material is chemically made of nucleotide which is either being synthesized in the body or being obtained from the environment similar to that of amino acids.

If the genetic code is same one organism descend from the other organism.But these statement does not supports that DNA was the first genetic material to found in living beings.

8 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Give two reasons for having a system of scientific names.
arlik [135]

Answer:

1. Without scientific names, scientists would not be able to differentiate from different "breeds" of a similar animal, such as a rat and a mouse. Using the binomial nomenclature, scientists are able to reference one specific animal.

2. Because there are animals found all over the world, many people have many different names for said animals.  A goat in one area of the world may be called a sheep in another, vise versa. Hope this helps!

Explanation:

7 0
4 years ago
A hurricane passes through the Gulf of Mexico and destroys many of the coastal regions of Northwest Florida,
BlackZzzverrR [31]

Answer:

A

Explanation:

7 0
3 years ago
Other questions:
  • How does solubility work?
    12·1 answer
  • Which factor has greatest importance in determining the characteristics of an aquatic ecosystem? A. day length B. water depth C.
    9·2 answers
  • 9. What type of cellular respiration requires oxygen?
    15·1 answer
  • Which amino acid--a, b, or c--actually falls between the other two in lysozyme primary structure (the order of the amino acids i
    9·1 answer
  • Why is it important for some reactions to be reversible?
    8·1 answer
  • an organism was hunted almost to Extinction but the population bounced back which evaluationary changed did the species most lik
    9·2 answers
  • What do dissociative and somatic symptom disorders have in common?
    12·1 answer
  • Gray-colored offspring are produced when a black bird and white bird of a certain species are crossed. What would be the predict
    15·1 answer
  • Population of town X has 5000 inhabitants and is under Hardy-Weinberg equilibrium for
    12·1 answer
  • I need help please . I can’t figure out how to do this
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!