1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bulgar [2K]
3 years ago
13

How might the surface of the Earth be different if it were not divided into tectonic plates?

Biology
1 answer:
REY [17]3 years ago
5 0

Answer:

Answer down below.

Explanation:

Well, for one thing, there would be no earthquakes. (I'm actually in this unit in my science class.) But there would also be no plate motion. If we started this Earth with no plate movement, really no plates at all, we might sink into the Mantle. Or, maybe would step somewhere, and the ground beneath us would give way to the weight. Like the GPGP (Great Pacific Garbage Patch), we might just float around the ocean. Plates are very important.

You might be interested in
What is the answer hurry
IRINA_888 [86]
I think the answer would be pesticides... i see you selected it though. was that a wring answer?
8 0
3 years ago
DNA and RNA are both organic molecules called
Leno4ka [110]

Answer:

Explanation:

Nucleic acids are the organic materials present in all organisms in the form of DNA or RNA. These nucleic acids are formed by the combination of nitrogenous bases, sugar molecules and the phosphate groups that are linked by different bonds in a series of sequences. The DNA structure defines the basic genetic makeup of our body.

3 0
2 years ago
Read 2 more answers
The first invertebrates to show both segmentation and a complete digestive system belong to the
Grace [21]
The first invertebrates to show both segmentation and a complete digestive system belong to the phylum Annelida that includes earthworms, leech, sandworms, etc.

These segmented worms have complete digestive system which is also known as tube-within a tube. These can be found in freshwater, marine water or can even be terrestrial.
4 0
3 years ago
Transcription is the process by which rna is assembled base by base off a dna template true or false
larisa [96]
This would be True. Hope I helped!
7 0
3 years ago
Can anyone fill these boxes please?
AveGali [126]

Answer:

Where the boxes please

Explanation:

6 0
3 years ago
Other questions:
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Describe the structure of saturated fatty acids! WILL MARK BRAINLIEST!!
    9·1 answer
  • During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleot
    9·1 answer
  • Plz help me well mark brainliest if correct!!
    12·2 answers
  • What substances are returned to the blood before it leaves the kidneys?​
    12·1 answer
  • 3 examples of complex interactions and scalping all 3
    6·1 answer
  • Air contains carbon dioxide, nitrogen, noble gases, oxygen and water vapour. Give three differences between the composition of t
    13·2 answers
  • Hi guys can you guys help me with this question b plss<br>​
    7·1 answer
  • What term describes the continuation of a visual sensation.
    7·1 answer
  • Chech the screenshot
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!