The correct answer is: cerebral cortex (prefrontal).
Cerebral cortex is the outer layer of cerebrum and it is the neural integration area of the brain. Globally, the role of cerebral cortex is role in memory, attention, perception, awareness, thought, language, and consciousness.
Prefrontal cortex is part of the cerebral cortex (cover the front part of frontal lobe). It is involved in complex social behavior of the human, complex cognitive behavior, decision making.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
In humans, the medulla region of the brain is mainly responsible for the regulation process of respiration. It is also called the respiratory rhythm centre. The chemosensitive area located near the respiratory centre sends signals across nerve impulses to alter the rate of expiration to eliminate compounds.
The correct answer is: [A]: "no double bonds" .
_____________________________________________________
<u>Note</u>: In saturated fatty acids, there is no double bonding between the molecules—which leaves a "gap" ; and saturation with "hydrogen (H)" atoms occur.
_____________________________________________________